ID: 1173769266

View in Genome Browser
Species Human (GRCh38)
Location 20:45644292-45644314
Sequence CAACAAAAAGGAAAGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173769266_1173769270 9 Left 1173769266 20:45644292-45644314 CCTGTCAGCTTTCCTTTTTGTTG No data
Right 1173769270 20:45644324-45644346 TTTGTTTGTTTGCTTGCTTGGGG No data
1173769266_1173769269 8 Left 1173769266 20:45644292-45644314 CCTGTCAGCTTTCCTTTTTGTTG No data
Right 1173769269 20:45644323-45644345 TTTTGTTTGTTTGCTTGCTTGGG No data
1173769266_1173769268 7 Left 1173769266 20:45644292-45644314 CCTGTCAGCTTTCCTTTTTGTTG No data
Right 1173769268 20:45644322-45644344 GTTTTGTTTGTTTGCTTGCTTGG No data
1173769266_1173769271 30 Left 1173769266 20:45644292-45644314 CCTGTCAGCTTTCCTTTTTGTTG No data
Right 1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173769266 Original CRISPR CAACAAAAAGGAAAGCTGAC AGG (reversed) Intergenic