ID: 1173769267

View in Genome Browser
Species Human (GRCh38)
Location 20:45644304-45644326
Sequence AAAACTCAACAACAACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173769267_1173769272 19 Left 1173769267 20:45644304-45644326 CCTTTTTGTTGTTGTTGAGTTTT No data
Right 1173769272 20:45644346-45644368 GCTTGCTTGTTTTTGAGACAGGG No data
1173769267_1173769270 -3 Left 1173769267 20:45644304-45644326 CCTTTTTGTTGTTGTTGAGTTTT No data
Right 1173769270 20:45644324-45644346 TTTGTTTGTTTGCTTGCTTGGGG No data
1173769267_1173769271 18 Left 1173769267 20:45644304-45644326 CCTTTTTGTTGTTGTTGAGTTTT No data
Right 1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG No data
1173769267_1173769268 -5 Left 1173769267 20:45644304-45644326 CCTTTTTGTTGTTGTTGAGTTTT No data
Right 1173769268 20:45644322-45644344 GTTTTGTTTGTTTGCTTGCTTGG No data
1173769267_1173769269 -4 Left 1173769267 20:45644304-45644326 CCTTTTTGTTGTTGTTGAGTTTT No data
Right 1173769269 20:45644323-45644345 TTTTGTTTGTTTGCTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173769267 Original CRISPR AAAACTCAACAACAACAAAA AGG (reversed) Intergenic