ID: 1173769271

View in Genome Browser
Species Human (GRCh38)
Location 20:45644345-45644367
Sequence GGCTTGCTTGTTTTTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173769266_1173769271 30 Left 1173769266 20:45644292-45644314 CCTGTCAGCTTTCCTTTTTGTTG No data
Right 1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG No data
1173769267_1173769271 18 Left 1173769267 20:45644304-45644326 CCTTTTTGTTGTTGTTGAGTTTT No data
Right 1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173769271 Original CRISPR GGCTTGCTTGTTTTTGAGAC AGG Intergenic