ID: 1173770149

View in Genome Browser
Species Human (GRCh38)
Location 20:45649266-45649288
Sequence CCAGCAGATGTTTCCACAAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173770145_1173770149 10 Left 1173770145 20:45649233-45649255 CCAAGCAAACATCTCCCAACTCA 0: 1
1: 1
2: 1
3: 20
4: 242
Right 1173770149 20:45649266-45649288 CCAGCAGATGTTTCCACAATAGG 0: 1
1: 1
2: 0
3: 10
4: 115
1173770144_1173770149 11 Left 1173770144 20:45649232-45649254 CCCAAGCAAACATCTCCCAACTC 0: 1
1: 0
2: 2
3: 19
4: 226
Right 1173770149 20:45649266-45649288 CCAGCAGATGTTTCCACAATAGG 0: 1
1: 1
2: 0
3: 10
4: 115
1173770146_1173770149 -4 Left 1173770146 20:45649247-45649269 CCCAACTCACGACGTTTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1173770149 20:45649266-45649288 CCAGCAGATGTTTCCACAATAGG 0: 1
1: 1
2: 0
3: 10
4: 115
1173770147_1173770149 -5 Left 1173770147 20:45649248-45649270 CCAACTCACGACGTTTATCCAGC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1173770149 20:45649266-45649288 CCAGCAGATGTTTCCACAATAGG 0: 1
1: 1
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173770149 Original CRISPR CCAGCAGATGTTTCCACAAT AGG Exonic
907270472 1:53288085-53288107 CCAGCAGATACTCCGACAATGGG - Intronic
907701526 1:56792700-56792722 CCAGCAGGTGTTTCTCCAAAGGG - Exonic
908409908 1:63853180-63853202 GCAGCAGCTGTTGCCACAGTTGG - Intronic
909205497 1:72751967-72751989 ACAGCATATTTTTCCAGAATAGG - Intergenic
911255956 1:95633880-95633902 CCATCACAAGTTCCCACAATAGG - Intergenic
912299142 1:108495549-108495571 CCAATAGATATTTCCACAACAGG + Intergenic
914254251 1:145948150-145948172 CAAGCAGATTATTCCACAGTTGG + Intronic
914453797 1:147816784-147816806 CCAGTAGATATTTCCATAGTGGG + Intergenic
917147882 1:171912010-171912032 CCAGCCCATGTTTCCAGGATTGG + Intronic
921071365 1:211660900-211660922 CCAGCAGATCTGTCCCCAGTGGG + Intronic
1075351723 10:121730433-121730455 CCAGCTGATTTTTCAAAAATTGG + Intergenic
1077541782 11:3150096-3150118 CCAGCAGCTGTTTCCCCTGTTGG + Intronic
1080761583 11:35255202-35255224 ACAGCAGAGGTGTCCACCATGGG + Exonic
1088434463 11:109795808-109795830 CCAGCAGAAGTTTCCAAATGTGG + Intergenic
1089601638 11:119619247-119619269 CCAGCAGCTGTGTCCCCATTAGG - Intergenic
1090077789 11:123590458-123590480 CCAGCAGATGTTTCCTGCAATGG - Intronic
1091323862 11:134669753-134669775 CCAGCAGCTGAGTCCACAGTGGG + Intergenic
1091684145 12:2549768-2549790 CCAGCAGATGTGTCCATCAAGGG + Intronic
1092294953 12:7190077-7190099 CCAGCAGCTGCCTCCACAAAGGG - Intronic
1093565714 12:20600637-20600659 CCTACAAATTTTTCCACAATTGG - Intronic
1097563128 12:61233634-61233656 CCATCACAGGGTTCCACAATAGG + Intergenic
1098918873 12:76284617-76284639 CCAGCAGATGTTTCTTTAACAGG + Intergenic
1099040129 12:77642412-77642434 AATGCAGATGTTTCCAAAATGGG + Intergenic
1103389086 12:120557349-120557371 GCAGAAGATGTGTCCACAACGGG - Exonic
1104218661 12:126760448-126760470 CCAACAGATATTTACACAGTGGG - Intergenic
1105483008 13:20796982-20797004 CCAGCAGATGTGTCAGCAAGAGG - Exonic
1109311369 13:60697970-60697992 GAAACAGATGTTTCCACATTTGG - Intergenic
1113206008 13:107916821-107916843 TAAGCACATTTTTCCACAATAGG - Intergenic
1113229098 13:108193750-108193772 ATGGCAGATTTTTCCACAATAGG - Intergenic
1119060170 14:71465767-71465789 CGATCACAAGTTTCCACAATAGG + Intronic
1121744485 14:96277589-96277611 CCAGCAGATGTTTGCTGAATGGG + Intergenic
1125007378 15:34832996-34833018 GCAGCAGATTTTACAACAATAGG + Intergenic
1125056386 15:35362481-35362503 CCAGCAGAGCTTGCCACATTTGG - Intronic
1128619543 15:69137263-69137285 CCAGCAACTGCTTCCACTATGGG + Intergenic
1132500378 16:282275-282297 CTAGCTGAGGTTTCCCCAATAGG + Exonic
1134057543 16:11180069-11180091 CCAGCAGATGTGCCCACCAGGGG + Exonic
1137901690 16:52275685-52275707 CCAGTAAATGTTTTCACAATTGG - Intergenic
1140769435 16:78190029-78190051 CCAGCACATGTGTCCACACTTGG + Intronic
1145277412 17:21441171-21441193 TGTGCAGATGTTTCCAGAATGGG + Intergenic
1145315250 17:21727066-21727088 TGTGCAGATGTTTCCAGAATGGG + Intergenic
1145713682 17:26999004-26999026 TGTGCAGATGTTTCCAGAATGGG + Intergenic
1146311518 17:31772114-31772136 CGAGCTGATGTGTCCAGAATTGG - Intergenic
1149143671 17:53464225-53464247 CCAGCACAGGTTTCCACATCTGG + Intergenic
1150072462 17:62163515-62163537 CCAGAAGATTATTCCCCAATGGG + Intergenic
1150942804 17:69711592-69711614 CCAGCAGATGTTTTCAATTTTGG + Intergenic
1151005219 17:70427956-70427978 CCAGCAGACTTTTCCCAAATCGG + Intergenic
1154933863 18:21030813-21030835 CCAGCAGATGTTGTCAAAAATGG + Intronic
1155153311 18:23138719-23138741 CCAGGAAAGGTTTCCACAAATGG - Intronic
1156887394 18:42151158-42151180 TCAACAGATGTTTCAACAGTTGG + Intergenic
1159692810 18:71511404-71511426 ATTCCAGATGTTTCCACAATAGG + Intergenic
1166956504 19:46468900-46468922 CCACCAGATGTCTCCAGCATCGG - Intronic
1166956613 19:46469505-46469527 CCACCAGATGTCTCCAGCATCGG + Intronic
926769771 2:16359704-16359726 CCAATAGATGTTTGCAAAATGGG - Intergenic
928567029 2:32563350-32563372 CCAGCAGATGTAGCTAAAATGGG + Intronic
932870821 2:75395985-75396007 GGAGCGGATGTTGCCACAATTGG + Intergenic
933015705 2:77123978-77124000 CAAGGAAATGTTTCCACTATGGG + Intronic
936879850 2:117236380-117236402 CCAGCAAATGATTTCACAATAGG + Intergenic
939098827 2:137870680-137870702 TAAGCAGATGTTTCCACAACAGG + Intergenic
943110474 2:183598090-183598112 CTAGCAGACCTTGCCACAATGGG + Intergenic
944469492 2:200037543-200037565 CAAGCACATGCTTCCACACTTGG + Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171225560 20:23439491-23439513 CCAGCAAATGTTTTTAAAATAGG + Intergenic
1172799566 20:37566463-37566485 CCAGCAGTTGTTTTCCCACTAGG + Intergenic
1173081066 20:39867984-39868006 CCATCAGAGTTTTCCACATTGGG - Intergenic
1173765843 20:45608671-45608693 TAAGCAGATGTTTCCACAGTAGG + Exonic
1173770149 20:45649266-45649288 CCAGCAGATGTTTCCACAATAGG + Exonic
1177384268 21:20388661-20388683 CCAGCAGATCTGTCCCCATTGGG - Intergenic
1177411417 21:20734795-20734817 TCAGCAGAGTTTTCCACAACTGG - Intergenic
1178045317 21:28687066-28687088 GTAGCAGCTGTTTCCACAGTGGG + Intergenic
949633040 3:5950131-5950153 CCATAAGATGTATCCACAAGGGG - Intergenic
951982759 3:28583641-28583663 CCAGCAGGGGTTTCCAGACTTGG + Intergenic
955078924 3:55639877-55639899 GAAGCAGATGTTTTCACACTTGG + Intronic
956919577 3:73912699-73912721 CCAGCTCATCTTTCCCCAATGGG - Intergenic
958158595 3:89787669-89787691 CCAGCAGATGTTTCTGCTTTGGG - Intergenic
960976020 3:123174656-123174678 CCAACAGAAGTTTACAAAATGGG - Intronic
962243867 3:133775307-133775329 CCAGCAGAAGTGCCCACACTGGG - Intronic
962502108 3:136005830-136005852 AAAGCAGATGTTTCTTCAATGGG - Intronic
966043776 3:175525420-175525442 CCATTAGATGTGTCCACAACAGG - Intronic
967093748 3:186159660-186159682 CAAGAAGATGTTTCAACAAGGGG + Intronic
967562992 3:190939354-190939376 GCAGAAGAAGTTTCCACAACTGG + Intergenic
967972020 3:195006119-195006141 ACAGCAGATTCTTCCACATTAGG - Intergenic
970695650 4:18673788-18673810 CCAGAGGATGTTGCAACAATTGG - Intergenic
982474901 4:155838121-155838143 CCTGGAGATATTTCCACAATGGG + Intronic
983260767 4:165453733-165453755 CCAGGAGATCATTCCACAAGAGG - Intronic
986671067 5:10143059-10143081 CCATCACAAGTTCCCACAATAGG - Intergenic
988105084 5:26734659-26734681 GATGCAGATGTTACCACAATTGG - Intergenic
989219611 5:38942311-38942333 TCAGCAGATGTATCAACTATAGG + Exonic
994648851 5:102502444-102502466 TCAGCAAATGTTTTCACAAAAGG + Intergenic
996922498 5:128785261-128785283 CTATCAGAAGGTTCCACAATAGG + Intronic
1002868612 6:1146205-1146227 CCCGCAGATGTGTGCAAAATGGG + Intergenic
1002885891 6:1293556-1293578 CCAGTAGCTGTTTCCTCACTGGG - Intergenic
1003844912 6:10163142-10163164 AGAGAAGATGTTTCCACCATAGG + Intronic
1003845902 6:10172993-10173015 AGAGCTGATGTTTCCGCAATTGG - Intronic
1003867038 6:10372661-10372683 CAGGCAGAATTTTCCACAATAGG - Intergenic
1005187149 6:23175479-23175501 CTAGCAGATGTTGCCAAAAAAGG + Intergenic
1007809879 6:44478211-44478233 CCAGCAGAAGCTGGCACAATGGG - Intergenic
1011954940 6:93015374-93015396 CCAGCAGAAGGTGCCAGAATTGG + Intergenic
1014888535 6:126812944-126812966 AAAGCAGATCTTTCCACACTTGG + Intergenic
1017410958 6:154167335-154167357 CCAGCAGATGTTTTCACAATGGG - Intronic
1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG + Intergenic
1018838513 6:167502622-167502644 CCAGGAAATGTGTCCACACTGGG + Intergenic
1020073105 7:5240382-5240404 CCCGCAGATGTCTGCACAGTTGG - Intergenic
1020475769 7:8592614-8592636 TTGGCAAATGTTTCCACAATGGG + Intronic
1021178683 7:17480692-17480714 CCAGCCTATGTTTCCCCAAGAGG - Intergenic
1022200897 7:28116275-28116297 ACTGCTGATGTTTCCACAACTGG + Intronic
1022905463 7:34851015-34851037 CTATCAGATTTTTCCACAAGTGG + Intronic
1024521564 7:50308974-50308996 CCTGCTGGTGTTTCCACAGTGGG + Intronic
1034350971 7:150414556-150414578 ACAGCAGGTGTCTCCACCATGGG - Intergenic
1035049332 7:155989674-155989696 CCTGCAGATGTCACCACATTGGG - Intergenic
1035936158 8:3842211-3842233 CAAGCAGATGATTCTACAAGAGG - Intronic
1038776219 8:30533326-30533348 ACAGCAGATGTTTCCAGAAGTGG + Intronic
1047617852 8:126577904-126577926 ACAGCAGCTGTTTTCAGAATGGG - Intergenic
1050919322 9:11181066-11181088 TCAGAAGATATTTCCCCAATGGG - Intergenic
1051471764 9:17451676-17451698 CCACCAGCTGTTTCCTCCATGGG + Intronic
1052001378 9:23285859-23285881 ACAAAAGATGTTTCCTCAATGGG - Intergenic
1052021185 9:23527349-23527371 CCAGCTGCAGTTTCCACACTTGG - Intergenic
1058158547 9:101542515-101542537 CTAGCAGATGTTTAGTCAATGGG + Intronic
1060260060 9:122066652-122066674 TCAGCAAATGTCTACACAATCGG + Intronic
1062480506 9:136748736-136748758 CCACCAGAAGGTTCCAGAATGGG + Intergenic
1185949598 X:4416927-4416949 CTAGCAGACATTTCCAAAATTGG - Intergenic
1186198551 X:7133328-7133350 TCAGAAGAGGTTTCCACAAGAGG + Intronic
1186686773 X:11933186-11933208 CCAGCAGCCTTTTCCACAATCGG - Intergenic
1187226711 X:17380163-17380185 CCAGGAGATGTTTCCAGAACTGG + Intronic
1194443239 X:93958497-93958519 CAAGCAGGTGTTTCCACTACTGG - Intergenic
1196127281 X:112113631-112113653 CAACCAGATGATTCAACAATAGG - Intergenic
1197409620 X:126099220-126099242 CAATCAGAAGTTCCCACAATAGG + Intergenic
1201749843 Y:17420682-17420704 CAAGCAGATGTTTCAGCAACAGG - Intergenic