ID: 1173776880

View in Genome Browser
Species Human (GRCh38)
Location 20:45715908-45715930
Sequence TCTCCTGGATGATATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173776880_1173776887 18 Left 1173776880 20:45715908-45715930 CCTTCAGGATATCATCCAGGAGA No data
Right 1173776887 20:45715949-45715971 ACAGGCCAACATTCAAATTCAGG 0: 1171
1: 3836
2: 3846
3: 2844
4: 1009
1173776880_1173776882 0 Left 1173776880 20:45715908-45715930 CCTTCAGGATATCATCCAGGAGA No data
Right 1173776882 20:45715931-45715953 ACTCCCCAACCTAGCAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173776880 Original CRISPR TCTCCTGGATGATATCCTGA AGG (reversed) Intergenic
No off target data available for this crispr