ID: 1173782442

View in Genome Browser
Species Human (GRCh38)
Location 20:45767729-45767751
Sequence AATAAAAAGGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3427
Summary {0: 1, 1: 2, 2: 52, 3: 454, 4: 2918}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173782438_1173782442 9 Left 1173782438 20:45767697-45767719 CCTATTTTAAAAACAACAACAAC 0: 1
1: 9
2: 84
3: 565
4: 2602
Right 1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG 0: 1
1: 2
2: 52
3: 454
4: 2918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173782442 Original CRISPR AATAAAAAGGAGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr