ID: 1173784661

View in Genome Browser
Species Human (GRCh38)
Location 20:45784000-45784022
Sequence CTTTTCCACTGGAGCTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173784661_1173784666 -8 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784666 20:45784015-45784037 TGGAAAAGGAAGCCCTATCTGGG 0: 1
1: 0
2: 1
3: 15
4: 209
1173784661_1173784667 -4 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784667 20:45784019-45784041 AAAGGAAGCCCTATCTGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
1173784661_1173784669 2 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784669 20:45784025-45784047 AGCCCTATCTGGGCTGGCCAGGG 0: 1
1: 2
2: 33
3: 1049
4: 865
1173784661_1173784665 -9 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784665 20:45784014-45784036 GTGGAAAAGGAAGCCCTATCTGG 0: 1
1: 0
2: 0
3: 13
4: 184
1173784661_1173784668 1 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784668 20:45784024-45784046 AAGCCCTATCTGGGCTGGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 189
1173784661_1173784674 22 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784674 20:45784045-45784067 GGGGCCAGAGCAGCTCACAAAGG 0: 1
1: 0
2: 1
3: 21
4: 262
1173784661_1173784670 3 Left 1173784661 20:45784000-45784022 CCTGCCAAGCTCCAGTGGAAAAG 0: 1
1: 1
2: 0
3: 15
4: 215
Right 1173784670 20:45784026-45784048 GCCCTATCTGGGCTGGCCAGGGG 0: 1
1: 0
2: 2
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173784661 Original CRISPR CTTTTCCACTGGAGCTTGGC AGG (reversed) Intronic
900348759 1:2224908-2224930 CTTTTCTTCCTGAGCTTGGCAGG - Intergenic
900678481 1:3903167-3903189 TTCATCCACTGGGGCTTGGCTGG + Intergenic
901377134 1:8847619-8847641 CATTTCCTATGGAGGTTGGCTGG + Intergenic
901448243 1:9320926-9320948 ACCTTCCACTGGAGCCTGGCAGG - Intronic
901582896 1:10260312-10260334 CTCTTACACTGGAGCTTGCAGGG + Intronic
901862893 1:12086129-12086151 CTATTCCACTGGAGCTGCGCGGG + Intronic
904384068 1:30130249-30130271 CTGTGCCAATGGAGCTGGGCGGG - Intergenic
905028865 1:34868456-34868478 CTTCTGCACTGGAGCGTGGCGGG - Intronic
905419299 1:37828762-37828784 TTTTTGCCCTGAAGCTTGGCAGG - Intronic
907250968 1:53139199-53139221 CTTTTTCACTGGGGCTGGGTGGG + Intronic
907460890 1:54604810-54604832 CTGTGCCACTGGGGCTTGGATGG + Intronic
912084553 1:105982411-105982433 CTCTTCCACTGTGGCTTTGCAGG - Intergenic
914267947 1:146053946-146053968 CTGTGACACTGGAGCATGGCAGG - Intergenic
916228525 1:162515736-162515758 CTTTAAAACTGAAGCTTGGCCGG + Intronic
917236314 1:172895904-172895926 CTTTTGAACTTGGGCTTGGCAGG + Intergenic
917815365 1:178704536-178704558 CTTTTCAGCTGGAGCTAGGGTGG + Intergenic
921700721 1:218265818-218265840 TTGTTCAACTGGAACTTGGCTGG + Intergenic
921800737 1:219399559-219399581 CTCTTACACTGCAGCTTTGCTGG - Intergenic
923621468 1:235582852-235582874 CTTTTCCCCTGGAGCTCTGGGGG - Intronic
923899068 1:238305554-238305576 CTTTTCCCCTGTGGCTTTGCAGG - Intergenic
1064954418 10:20892151-20892173 CTTGTCCTCTGGGGCTGGGCAGG - Intronic
1066981266 10:42418577-42418599 CTTCTCCACTGTAGCTGAGCTGG + Intergenic
1067209689 10:44249764-44249786 CTGGTACACTGGAGCTTGGTGGG - Intergenic
1070209994 10:74307097-74307119 CATTTCCACTGGGGTTTGGGGGG - Intronic
1073511081 10:104042722-104042744 CCTTCTCACTGGAGCTTGTCAGG + Intronic
1073745881 10:106467626-106467648 CTGGGACACTGGAGCTTGGCAGG + Intergenic
1073823334 10:107291100-107291122 CTATTGTACTGCAGCTTGGCTGG + Intergenic
1076157795 10:128216687-128216709 GTTTTCCACTGGAGCTGGAAGGG + Intergenic
1076218763 10:128716460-128716482 CTTTTCCAGTTGAGCTTGCAGGG + Intergenic
1077366817 11:2164596-2164618 CTTTTCCACTAGAGACTGCCGGG + Intronic
1077506961 11:2934076-2934098 CTCTTCCACTGGAGCCTGACAGG + Intergenic
1078151065 11:8760025-8760047 CTTTTCCACAGGAATTTAGCAGG - Intronic
1079577823 11:22025340-22025362 CTTGCTCACTGGAGCCTGGCTGG + Intergenic
1080851475 11:36073845-36073867 CTAGTCCTCTGGAGCTGGGCTGG + Intronic
1081418305 11:42841705-42841727 CCTTTCCCCTGTAGCCTGGCTGG + Intergenic
1083911858 11:65714473-65714495 ATTTTCCACTGGCCCTGGGCAGG + Exonic
1088846712 11:113674288-113674310 ATTGTTCTCTGGAGCTTGGCTGG + Intergenic
1092170566 12:6371504-6371526 GCTTTCCATTGGAGCGTGGCGGG + Intronic
1092816901 12:12320322-12320344 CCTCTCCACTGCAGCTTGGAAGG + Intergenic
1096096331 12:48938021-48938043 CTGTTCCTCTGGAGCTTGACTGG - Exonic
1096183001 12:49560854-49560876 CTTTCTCAGTGGAACTTGGCTGG - Intronic
1097966209 12:65584206-65584228 CTCTGCCACTGGAGGATGGCTGG + Intergenic
1098131583 12:67356590-67356612 TTTCACCACAGGAGCTTGGCTGG + Intergenic
1100842231 12:98624435-98624457 CTTCTCCACTGGAGTTAGGAGGG - Exonic
1101593336 12:106141176-106141198 CTTTTCCAATGCAGATTGGCTGG - Intergenic
1101712539 12:107281931-107281953 CTTTACCTCTGTAGCTTTGCAGG + Intergenic
1101831627 12:108262467-108262489 CTGTTCCACTGGGCATTGGCTGG + Intergenic
1102357879 12:112255038-112255060 CTTTTCCAGTGGTCCCTGGCTGG - Intronic
1102794774 12:115679246-115679268 CTTTGCCCCTGTAGCTTTGCAGG - Intergenic
1108435938 13:50401615-50401637 CTTTTCCCCTGGGGCGTGGAGGG - Intronic
1109681568 13:65758406-65758428 CTTTTGTACTGGGGCTTGGGAGG - Intergenic
1111164830 13:84446068-84446090 TTCTTCCACAGGAGTTTGGCAGG - Intergenic
1113694671 13:112335984-112336006 CCTCTCCTCTGGTGCTTGGCTGG - Intergenic
1114503298 14:23188251-23188273 CTTTCCCACTAGTGCTGGGCTGG - Intronic
1114778363 14:25512237-25512259 CTTCTCCACAAGAGCTTTGCGGG + Intergenic
1116433622 14:44873651-44873673 CTGGGACACTGGAGCTTGGCAGG - Intergenic
1123925719 15:25108497-25108519 CTATTCCTTTGGTGCTTGGCTGG + Intergenic
1124369596 15:29096316-29096338 GTTTTCCACTGGAGGCTGGGTGG + Intronic
1124602798 15:31148996-31149018 CTCTTCCACTGCAGCTTGGAGGG - Intronic
1125251846 15:37713752-37713774 CTTTTCCCCTGTGGCTTTGCAGG - Intergenic
1125902004 15:43357233-43357255 CTTTTCATCTGGAGTTTGGAGGG + Intergenic
1126299167 15:47175729-47175751 TTTGTCCACTGAAGCTAGGCTGG - Intergenic
1126776712 15:52106721-52106743 CTTTTCCACTGGAGTATGGAGGG - Intergenic
1127679205 15:61276182-61276204 CTTCTGCCCTGGAGCTTGGCTGG + Intergenic
1128323092 15:66706124-66706146 CTGTTCTACTGCAGCTTGCCAGG - Intronic
1128900992 15:71422865-71422887 CTATTCTACTGCAGCTTAGCTGG + Intronic
1130956552 15:88630929-88630951 CTATTCCACTGTAGCCTAGCAGG - Exonic
1131413788 15:92233443-92233465 TTTTCCCACAGGAGCTTAGCAGG + Intergenic
1134354778 16:13471510-13471532 TTTTTCCACTTCAGCTTGGAAGG - Intergenic
1135883523 16:26282394-26282416 CTTTTGCACTTGAACTTGGGAGG + Intergenic
1138141875 16:54575771-54575793 TTTTTCCCCTTGAGCTGGGCAGG - Intergenic
1138947117 16:61864716-61864738 TATTTCCCCTAGAGCTTGGCTGG - Intronic
1139499019 16:67345465-67345487 CTTTTCCTCTTGAGTTTGCCAGG + Intronic
1140802597 16:78502111-78502133 CACATCCACTGGAGCTTTGCAGG + Intronic
1140905044 16:79402616-79402638 CCTTTCCCCTGGAGCTGGGCTGG - Intergenic
1141145191 16:81524313-81524335 CTGTCCCACTGGAGCTTAGAGGG + Intronic
1144068401 17:11644907-11644929 CTTTTCCAGTGTAGTTTTGCTGG + Intronic
1144458593 17:15439203-15439225 CATTTCAACTGGAGTTTTGCAGG + Intronic
1147169007 17:38607273-38607295 CTGTCCCACTGGAGCTGGGAAGG - Intergenic
1148379946 17:47189112-47189134 CTTCTTCTCTGGGGCTTGGCTGG - Intronic
1151319847 17:73346461-73346483 CTTTAACACTGCAGCCTGGCTGG - Intronic
1153378710 18:4411635-4411657 CTTCTCCACGTGAGATTGGCTGG + Intronic
1155640802 18:28011846-28011868 CTTTTCCTCAAGAGCTTGTCAGG - Exonic
1155963573 18:32016217-32016239 CTTCTCCACTGGCTCTGGGCTGG - Intergenic
1156235852 18:35204214-35204236 CTTTGCTAATGGAGCTTGGTGGG - Intergenic
1156517400 18:37692263-37692285 CTGATCCACAGGAGCTGGGCAGG + Intergenic
1159943813 18:74428869-74428891 CTTCTCCACAGGAGATGGGCAGG - Intergenic
1160858364 19:1227392-1227414 CTTTTGCAGTGGGGCCTGGCGGG - Intronic
1164146101 19:22513501-22513523 CTTGTCCACTTGAGCTTTCCAGG + Intronic
1164160258 19:22621564-22621586 CTTGTCCACTTGAGCTTTCCAGG - Intergenic
1165654776 19:37523696-37523718 CTTATCCTCTGGAGCTGGGATGG + Intronic
1166851366 19:45763071-45763093 GTTTTCCACTGTGGCTTGGGGGG - Intronic
1202709293 1_KI270714v1_random:8297-8319 CTGTGACACTGGAGCATGGCAGG + Intergenic
927570203 2:24152869-24152891 CTTTTCTACTGCAGCTCAGCTGG + Intronic
928239009 2:29570383-29570405 GTTTTCCAAGGAAGCTTGGCAGG + Intronic
929313385 2:40451177-40451199 CTCTGCCTCTGGAGCTTTGCTGG - Intronic
929479978 2:42296392-42296414 CATTTCCCCTGGGGATTGGCAGG + Intronic
930191800 2:48467150-48467172 CTTATCCAGTTGAGCTTGGGGGG + Intronic
930212656 2:48657732-48657754 CTTTTCCTCTGCAGCCTTGCTGG + Intronic
932138317 2:69251693-69251715 TATCTCCACAGGAGCTTGGCTGG - Intergenic
932952744 2:76313469-76313491 CTTTACCACTGCAGCCAGGCTGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933439756 2:82297516-82297538 CCTTTCCCCTGCAGCTTTGCAGG + Intergenic
935039869 2:99415859-99415881 CTTTTTCTCTGGATCTTTGCAGG - Intronic
935283132 2:101536674-101536696 TTTGTCCCCAGGAGCTTGGCAGG - Intergenic
936485162 2:112919236-112919258 CTTTTCCACTATCACTTGGCTGG - Intergenic
936915777 2:117637820-117637842 CTTTGCCCCTGTAGCTTTGCAGG - Intergenic
937560953 2:123223464-123223486 CTTTTCCCCTGTGGCTTTGCAGG + Intergenic
938260614 2:129892670-129892692 CTTTGTCACAGGAGCTTGGCAGG + Intergenic
940381288 2:153017878-153017900 CTTTGCCCCTGTAGCTTTGCAGG + Intergenic
944133199 2:196369701-196369723 CTATTCCACTGCAGCTGAGCTGG + Intronic
947463824 2:230324430-230324452 CTTGTGCACTTGAGCTTGGAGGG + Intergenic
948607043 2:239142480-239142502 CATTTGCACTGGGACTTGGCGGG - Intronic
949045270 2:241869963-241869985 CTTTTCCACGGGACCTTGGGTGG + Intronic
1173784661 20:45784000-45784022 CTTTTCCACTGGAGCTTGGCAGG - Intronic
1174892007 20:54405312-54405334 ATTTTCCACTGGTGGTTTGCAGG + Intergenic
1175771420 20:61627025-61627047 CTTTTCCCCTAAAGCTTGTCTGG - Intronic
1176045505 20:63090744-63090766 CATTTCCACTGGACCCTTGCGGG + Intergenic
1177173007 21:17674697-17674719 CTTTTCATCTGGAGCTGGCCTGG + Intergenic
1178606176 21:34037855-34037877 CATTTGCACTGGTGTTTGGCAGG + Intergenic
1181263221 22:21613670-21613692 TTTTTACTCTGGAGGTTGGCTGG + Intronic
1182852761 22:33490063-33490085 CTTTCCCTCTGGAGCTAGGGGGG + Intronic
951781414 3:26367322-26367344 CTTTTCCTCTGGAGTATGTCAGG + Intergenic
952862113 3:37821663-37821685 CTTCTCCAGTGGGGCTTTGCTGG - Exonic
956256329 3:67286846-67286868 CTTTTCCACTGCAAATTAGCAGG - Intergenic
958682907 3:97353676-97353698 CTTTTCCACTGGCCCATGGTAGG - Intronic
960738240 3:120803988-120804010 ATTTTCCACTGGACATGGGCGGG + Intergenic
960915605 3:122691328-122691350 CTTGTCCACTGAAGCATGGTGGG - Intronic
961176195 3:124837081-124837103 CTTGTACATTTGAGCTTGGCTGG - Intronic
961313116 3:126016389-126016411 CATTGCCACTAGAGCTTTGCTGG - Intronic
961360394 3:126363648-126363670 CATTTCCACACGAGCTTGGGAGG + Intergenic
962195051 3:133354446-133354468 CATCTCCACGGGAGCTTTGCAGG + Intronic
962863148 3:139423311-139423333 TTTTTCCTTTGGTGCTTGGCTGG - Intergenic
963711062 3:148747811-148747833 CTTTTCCATTGGATTTCGGCAGG - Intergenic
964198586 3:154092002-154092024 TTTTTCCACTGGTGTTTGGCTGG + Intergenic
964965003 3:162481598-162481620 CTTTTCTACTGTGGCTTAGCTGG + Intergenic
965059947 3:163772859-163772881 CTTTTCTTCTGCAGCTTAGCTGG + Intergenic
965955160 3:174360909-174360931 CTTTTCCACTGTGGGTTGACAGG - Intergenic
965967049 3:174505256-174505278 CTCTGCCACTGATGCTTGGCAGG - Intronic
967523339 3:190462167-190462189 CTTTTACATTGGAGCTTTCCTGG - Intergenic
969924770 4:10575557-10575579 CTTTCCCTGTGGTGCTTGGCTGG + Intronic
972688638 4:41374835-41374857 CTTTTCCACTAAAGGCTGGCTGG + Intronic
972902316 4:43700253-43700275 CTATTCTACTGCAGCTTAGCTGG + Intergenic
974009354 4:56592943-56592965 CTTTTCAAATGGATGTTGGCAGG - Intronic
975469949 4:74754396-74754418 CTTATCCACTGGAGCATAACTGG - Intronic
975914976 4:79313770-79313792 CTGTTTCACTGGATTTTGGCTGG + Intronic
976762822 4:88568804-88568826 CTCTTCCACTGCAGCTGAGCTGG + Intronic
977041405 4:92024157-92024179 CTTTGCCCCTGTAGCTTTGCAGG + Intergenic
977097887 4:92769306-92769328 CTTTGCCCCTGTAGCTTTGCAGG + Intronic
979184590 4:117772523-117772545 CTGTTCTACTGTAGCTTAGCTGG - Intergenic
979645212 4:123060120-123060142 CTCTGCCTCTGTAGCTTGGCAGG + Intronic
980477300 4:133334191-133334213 CTGGGACACTGGAGCTTGGCTGG - Intergenic
980489363 4:133505646-133505668 TTTTCCCCCGGGAGCTTGGCAGG - Intergenic
980896641 4:138866595-138866617 GTTTTCCACTGGAGGGTGGTTGG - Intergenic
982938562 4:161518825-161518847 CTTTGCAAATGTAGCTTGGCTGG + Intronic
985103705 4:186482204-186482226 CAGTTCCACTGCAGCTGGGCAGG - Intronic
987462053 5:18223660-18223682 CTTTTCCTCTGTGGCTTTGCAGG - Intergenic
987639013 5:20587239-20587261 ATTTTCCACTGTAGCTTTGTAGG - Intergenic
989657665 5:43761745-43761767 CTGTTCCACTGTGGCTTAGCTGG + Intergenic
992257457 5:74935290-74935312 CATTTCCTTTGGAGCTTGACTGG - Intergenic
993141975 5:84045313-84045335 CTTCTCCACCTGAGCTTTGCTGG - Intronic
994752039 5:103750236-103750258 CTTTTCCATTAGAGCTTGTTGGG - Intergenic
995272985 5:110243774-110243796 CTTTGGCACTGGATCTTGACAGG + Intergenic
996948668 5:129098964-129098986 CTTTGCCTCAGGAGCGTGGCAGG + Intronic
1000045830 5:157521410-157521432 CTTTGCCACTGTAAATTGGCAGG + Intronic
1003082265 6:3030969-3030991 CTTTTCCACATGAATTTGGCAGG - Intergenic
1003417991 6:5930101-5930123 CATTTCATCTGGAGCTTGACTGG - Intergenic
1003611024 6:7615089-7615111 GTTTGCCACTGGAACTAGGCAGG - Intergenic
1004054062 6:12116610-12116632 CTCTACCACTGGTGCTTGGGAGG - Intronic
1004887685 6:20067368-20067390 CTTTGCTACTGGAGCATAGCAGG - Intergenic
1005441750 6:25876733-25876755 GTCATTCACTGGAGCTTGGCTGG + Intronic
1005463640 6:26091463-26091485 CTTTCCCACTCCAGCTTGGTGGG - Exonic
1006584003 6:35093809-35093831 TTTTTCCTGTGGTGCTTGGCTGG - Intergenic
1006643066 6:35498229-35498251 GTTTTCCGCGGGAGCTTTGCTGG + Exonic
1006741195 6:36310267-36310289 CTCTTCTCCTGGAGCTTGGGTGG + Intergenic
1006899701 6:37492007-37492029 CCTTACCCCTGGAGCTGGGCAGG + Intronic
1008641969 6:53473711-53473733 CTCTTCCACTGCAGCTGAGCTGG + Intergenic
1009266447 6:61561524-61561546 CTATTCTACTGCAGCTTAGCTGG + Intergenic
1009316763 6:62229534-62229556 CCTCCCCACTGGAGCTCGGCTGG + Intronic
1010158260 6:72820932-72820954 CTGTGTCACTGGAGTTTGGCTGG + Intronic
1012581732 6:100878614-100878636 CTTTTCCACTGGACTTTCGTGGG - Intronic
1014292115 6:119570879-119570901 TTTTTCCACTGATGTTTGGCTGG - Intergenic
1014391279 6:120868669-120868691 CTTTTCCACTGCAGGTTAGATGG + Intergenic
1014635631 6:123843352-123843374 ATCTTCCCCTGGAGTTTGGCTGG + Intronic
1016134440 6:140521852-140521874 CTTATCCACTCCAGCTTGTCAGG - Intergenic
1016228420 6:141771665-141771687 CTGTTCCCCTGGAGCTGAGCTGG + Intergenic
1016826630 6:148394217-148394239 CTTTTCCACTGCAACTTGTCTGG - Intronic
1017218299 6:151936103-151936125 CCTTTACAGTGGAGCTTGGGAGG - Intronic
1017768900 6:157629748-157629770 CTTTTCCACATCAGCTGGGCAGG + Intronic
1017946591 6:159100987-159101009 CTGTTCCACAGCAGCCTGGCTGG + Intergenic
1022877040 7:34544828-34544850 TTTTTCCCTTGGAGTTTGGCCGG - Intergenic
1023585871 7:41729255-41729277 CTTTTCTTCTGGAGTTGGGCTGG - Intergenic
1026011714 7:66641408-66641430 CTTCTCCCATGGAGCATGGCAGG + Exonic
1028269639 7:88772928-88772950 CTTTTCCTCTGTATCTGGGCAGG + Intronic
1029590268 7:101502658-101502680 CTGTTCCACTGCAGCCTGGGAGG + Intronic
1030966353 7:115996901-115996923 CTTTTCTACTGCAGCTGAGCTGG - Intronic
1034453692 7:151152289-151152311 CTTATGCACTGGAGCTGGGCGGG - Intronic
1038715418 8:29986677-29986699 CTCTCCCACTGGACCTTGGGAGG + Intergenic
1039039699 8:33395474-33395496 ATCTTCCCCTGGAGTTTGGCCGG - Intronic
1039476752 8:37842812-37842834 CTTTTCCTCCCGAGTTTGGCTGG + Exonic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1040746265 8:50645935-50645957 CTTTTCCCAGGCAGCTTGGCTGG + Intronic
1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG + Intronic
1046708823 8:117486969-117486991 CTTATCCCCAGGAACTTGGCAGG - Intergenic
1047208653 8:122822852-122822874 CGTTTCTGCTGGAGCTGGGCAGG + Intronic
1048038307 8:130699339-130699361 CTTATCCACAGAGGCTTGGCGGG + Intergenic
1048472002 8:134712481-134712503 CTCTTTGACTGGACCTTGGCGGG - Intronic
1049487189 8:142872259-142872281 CTCTGCCCCTGCAGCTTGGCTGG - Intronic
1049790472 8:144470030-144470052 CTTTTCCACAGGTGTCTGGCAGG - Intronic
1049837492 8:144747390-144747412 ATGTTCCACATGAGCTTGGCAGG + Intronic
1053310811 9:37018283-37018305 TTTTTTCACTGGAGCCTGGTTGG - Intronic
1055905928 9:81293043-81293065 CTTCTCCAGTGGAGCGGGGCGGG + Intergenic
1056581980 9:87895267-87895289 TTTTTCCATTGGTGTTTGGCTGG + Intergenic
1057644445 9:96859779-96859801 CTTCTCCACTGTAGCTGAGCTGG - Intronic
1058194699 9:101957898-101957920 TTTTTCCATTGGTGTTTGGCAGG + Intergenic
1058234601 9:102474223-102474245 GTTTTTCACTGGGGCTTGGATGG + Intergenic
1059434568 9:114268192-114268214 TGTTTCCACTGGAGCAGGGCTGG + Intronic
1059434593 9:114268326-114268348 TGTTTCCACTGGAGCAGGGCTGG + Intronic
1059442210 9:114314773-114314795 CTTTACCTCTGGGCCTTGGCAGG - Intergenic
1061209325 9:129181736-129181758 CTTTCCCCCTGGAGCTGGGGAGG + Intergenic
1187314464 X:18179838-18179860 CTCTGCCACTGTGGCTTGGCAGG + Intronic
1187725698 X:22199983-22200005 CTTTTCCACTAGGGCTTTACAGG + Intronic
1189868148 X:45352795-45352817 CATTTGCACTTGAGCTTGGGAGG + Intergenic
1191886554 X:65894401-65894423 CTGTGACACTGGAGCTTGGCAGG - Intergenic
1192374935 X:70549732-70549754 CTATTCTACTGCAGCTTAGCTGG - Intronic
1193587963 X:83350552-83350574 ATTTTAAACTGTAGCTTGGCTGG - Intergenic
1194133155 X:90106564-90106586 CCCTTCCCCTGGAACTTGGCAGG + Intergenic
1194215738 X:91128644-91128666 CTCTGCCACTGTAGCTTTGCAGG + Intergenic
1194500822 X:94679031-94679053 CTATTCCACTGCAGCTGTGCTGG + Intergenic
1196247451 X:113416068-113416090 CTTTTGCACTGCAGCTGAGCTGG - Intergenic
1198420309 X:136465155-136465177 TTTTTCAACTGGTGTTTGGCTGG + Intergenic
1200478942 Y:3676639-3676661 CCCTTCCCCTGGAACTTGGCAGG + Intergenic