ID: 1173785477

View in Genome Browser
Species Human (GRCh38)
Location 20:45790043-45790065
Sequence GCTGAGGTATGAGCAGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173785472_1173785477 -6 Left 1173785472 20:45790026-45790048 CCTTGCCCAGAGTATCAGCTGAG 0: 1
1: 0
2: 0
3: 19
4: 308
Right 1173785477 20:45790043-45790065 GCTGAGGTATGAGCAGGACTAGG 0: 1
1: 0
2: 1
3: 30
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173785477 Original CRISPR GCTGAGGTATGAGCAGGACT AGG Intronic
900625583 1:3607142-3607164 GCTGAGGTTTGAGGAGGGCCGGG - Intronic
900782268 1:4625985-4626007 GCTGAGATCTGTGCAGGGCTGGG + Intergenic
901608681 1:10479275-10479297 GCTGAGGTGAGAGCATCACTTGG + Intronic
902578515 1:17393858-17393880 GTTGAGGGTTGAGCAGGAGTTGG + Intronic
902915345 1:19635398-19635420 CTTGAGATATGAGCAAGACTTGG - Intronic
904038842 1:27572800-27572822 GTTGAGGTGTGTGCAGGACAAGG - Intronic
904084084 1:27891795-27891817 GCTGAAAGATGAGCAGGACCAGG - Exonic
904240418 1:29141007-29141029 GCTGAGGCATGAGAATCACTTGG - Intergenic
904421834 1:30399082-30399104 GCTATGGTGTGAGCAGCACTGGG - Intergenic
905195050 1:36269668-36269690 GCTGAGGTAAGAGGATGGCTTGG - Intronic
905231161 1:36515661-36515683 GCCAAGGTCTGAGCAGGAGTGGG - Intergenic
905377332 1:37532020-37532042 GCTGAGGTAGGAAGAAGACTAGG + Intergenic
905641490 1:39593010-39593032 CATGAGGTATGAGCAGGATGTGG - Intergenic
906159550 1:43637630-43637652 GCGGAGGTAAGAGAAGGATTCGG + Intergenic
906621475 1:47284456-47284478 GCTGAGGTAGGAGGATCACTTGG - Intronic
907352818 1:53847279-53847301 GCTGAGGCAGGAGAAGAACTTGG - Intergenic
907701661 1:56794203-56794225 GCAGAGGAAGGAGCATGACTGGG + Intronic
907746451 1:57218443-57218465 GCTGAGGTAGGAGGATCACTTGG + Intronic
907920323 1:58905479-58905501 GCAGAGTTAAGAGCAGGAGTAGG + Intergenic
908746634 1:67382803-67382825 GCTGAGGCATGAGAATCACTTGG - Intronic
908774096 1:67623879-67623901 GCTGAGGTGTGAGGATGGCTTGG - Intergenic
909020281 1:70423469-70423491 GCTGAGGTAGGAGGATCACTTGG + Intronic
909458496 1:75878719-75878741 GCTGAGGTAGGAGGATCACTTGG + Intronic
909479645 1:76117655-76117677 GCTGAGCTTTGAGAAGGTCTAGG + Intronic
909595114 1:77397800-77397822 GCTGAGGCAGGAGCATCACTTGG + Intronic
910157835 1:84240414-84240436 GATGCGGCATGAGAAGGACTTGG - Intergenic
910242452 1:85101965-85101987 GCTGAGGCAGGAGGATGACTTGG + Intronic
910869079 1:91815200-91815222 GCTGAGGTAGGAGAATCACTTGG + Intronic
910876441 1:91883237-91883259 GCTGAGGTAGGAGGATCACTTGG - Intronic
911431063 1:97788112-97788134 CATGAGGTATGTGCAGGACGTGG + Intronic
912651133 1:111440691-111440713 TCTGAGGAAGAAGCAGGACTTGG - Exonic
913492598 1:119395318-119395340 GCTGAGGTAGGAGAATCACTTGG + Intergenic
913520206 1:119638547-119638569 AGTGAAGTATGAGGAGGACTAGG - Intronic
915013492 1:152712099-152712121 GCAGAGCTATGACTAGGACTGGG + Intergenic
915037544 1:152941496-152941518 GAGGAGGCATGAGCCGGACTGGG + Intergenic
915187903 1:154122949-154122971 GCTGAGGTAGGAGGATCACTTGG + Intronic
915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG + Intergenic
915378112 1:155415876-155415898 GCTGGGGTTTCAGAAGGACTGGG + Exonic
915856511 1:159393267-159393289 GCTGAGGCAGGAGAAGCACTTGG + Intergenic
915980040 1:160414827-160414849 TCTGAAGAATGAGCAGGATTTGG + Intronic
917092529 1:171368021-171368043 GCTGAGGTAGGAGGATGGCTTGG + Intergenic
917114313 1:171586678-171586700 GCTGAGGCATGAGAATCACTTGG - Intronic
917727267 1:177839648-177839670 CCTGAGGTGTCAGCAGGCCTAGG - Intergenic
918605439 1:186419471-186419493 GCTGAGGTAGGAGCATCACCTGG + Exonic
919623976 1:199893155-199893177 GCTGAGGCAGGAGCATTACTTGG + Intergenic
919695876 1:200574717-200574739 TCTGAGGTCTAAGCAGAACTAGG + Intronic
919712176 1:200739282-200739304 GCGGAGGGACGAGCAGGACGAGG - Intergenic
919951940 1:202372671-202372693 GCTGAGGTAGGAGGACCACTTGG + Intronic
921268630 1:213447316-213447338 GCTGGGGTATGAGGAGGCCAAGG - Intergenic
921641657 1:217561994-217562016 GCTCAGGTATGTTCAGAACTTGG - Intronic
922114878 1:222603231-222603253 GCTGAGGTAGGAGGATCACTAGG - Intergenic
924751295 1:246894102-246894124 GCTGAGGCAGGAGGATGACTTGG + Intronic
1062920946 10:1279413-1279435 GCTGAGCTAAGAGGATGACTTGG - Intronic
1063081331 10:2770537-2770559 GCTGAGGCATGAGAATCACTTGG - Intergenic
1063149313 10:3322207-3322229 GCAGAGGCAGGAGCAGCACTGGG + Intergenic
1065766988 10:29039474-29039496 CCTGAGCCAGGAGCAGGACTAGG - Intergenic
1065872402 10:29966783-29966805 GCTGAGGTAGGAGGATTACTTGG - Intergenic
1067066578 10:43107224-43107246 ACTGAGGAATGAACAGGACCAGG - Intronic
1067540802 10:47150909-47150931 CCCGAGGAATGAGCATGACTGGG + Intergenic
1069523169 10:69142284-69142306 GCTGAGGTAGGAGGATTACTTGG - Intronic
1069608861 10:69758962-69758984 GCTGACATGTGAGCAGGACAGGG - Intergenic
1069787396 10:70997617-70997639 ACTGAGGTGTGAACAGCACTTGG - Intergenic
1070298174 10:75183089-75183111 GCTGGAATATGAGCAGGTCTTGG - Intergenic
1070357572 10:75655633-75655655 CCTGAGGTCTGGGCAGGACCAGG + Intronic
1070689662 10:78515306-78515328 GCTGAGGTCTGAGCAGGCTTGGG - Intergenic
1070794724 10:79210009-79210031 GCTGAAGGATGAGGAAGACTGGG - Intronic
1070909979 10:80109516-80109538 GCTGAGGCATGAGAATCACTTGG - Intergenic
1071279659 10:84088894-84088916 GCTGAGGTCTGAGGGGCACTTGG + Intergenic
1072789659 10:98309098-98309120 GGTGAGGTATCTGCAGGAGTTGG - Intergenic
1072946407 10:99813613-99813635 GCTGAGGCATGAGAATCACTTGG + Intronic
1074255810 10:111801535-111801557 CCTGAGGTAAGAGCAGGGTTAGG + Intergenic
1074519839 10:114209117-114209139 GCTGAGGTGGGAGGAGGGCTTGG + Intronic
1075918619 10:126191099-126191121 GCTGAGGCATGAGAATCACTTGG - Intronic
1076889007 10:133274952-133274974 GCTGAGGTAAGGACAGGGCTGGG + Intronic
1077046270 11:547130-547152 GCTGAGGCATGAGAATCACTTGG + Intronic
1077186455 11:1237476-1237498 GCTGAGGACTGGGCAGGTCTGGG - Intronic
1077210347 11:1368299-1368321 GCTGAGGTAGGGGCAGGACTTGG - Intergenic
1077627014 11:3781084-3781106 GCTGAGGTATGAGGAGTGCTTGG + Intronic
1077701216 11:4443990-4444012 GCTGAGGGGTGAGCACAACTTGG + Intergenic
1078352120 11:10603244-10603266 GCTGAGGACTGAACAGGAGTAGG + Exonic
1078788851 11:14523681-14523703 GCTGAGGTAGGAGGATCACTTGG - Intronic
1078869172 11:15327976-15327998 GGTGGGGAATGAGCAGGAGTGGG + Intergenic
1078917744 11:15795868-15795890 GCTGAGGTCCTAGCAGGCCTTGG - Intergenic
1080872386 11:36248229-36248251 GCTGAGGTAGGAGGATGGCTTGG - Intergenic
1081806792 11:45895260-45895282 GCAGAGGCAGGAGCTGGACTAGG + Intronic
1082084103 11:48035036-48035058 GCTGAGGAAATAGCAGGATTCGG - Intronic
1082182352 11:49134830-49134852 GCTGAGGTGTCTGCAGAACTGGG - Intergenic
1082201250 11:49371428-49371450 GCTGAAGTATGATTAGGATTAGG - Intergenic
1082770908 11:57206786-57206808 GCTGAAGGAAGAGCAGGAGTTGG - Intergenic
1083167471 11:60899690-60899712 GCACAGGTCTGAGCAGTACTGGG + Intronic
1083346024 11:61992741-61992763 GCTGAGGTAGGAGAATGTCTTGG + Intergenic
1083551517 11:63593653-63593675 GCTGAGGCACGAGCAGGAGGCGG - Intronic
1083551522 11:63593678-63593700 GCTGAGGCACGAGCAGGAGGCGG - Intronic
1083559604 11:63662577-63662599 GCTGAGGTGGGAGGATGACTTGG - Intronic
1083631041 11:64095685-64095707 GCGGAGGTCTGAGGAGGGCTGGG + Intronic
1083651625 11:64207831-64207853 GCTGAGGTCTGAGGGGGTCTAGG + Intronic
1083673199 11:64311361-64311383 GCTGTGGTATGTGCAGGAAGGGG + Intronic
1083848138 11:65348479-65348501 GCTGAGGTAGGAGGATCACTTGG + Intronic
1083853638 11:65381491-65381513 GCTGAGGTAGGAGGATCACTTGG - Intronic
1084130247 11:67128100-67128122 GCTGAGGTAAGAGGATCACTTGG - Intronic
1084349548 11:68586026-68586048 GCTGAGGTAGGAGGATTACTAGG + Intronic
1084432343 11:69118122-69118144 GCTGAGGTAGGAGGATCACTTGG - Intergenic
1084546710 11:69818461-69818483 GCTGGGGTTCGAGCAGAACTCGG - Intronic
1085075484 11:73587587-73587609 GCTGAGGCAGGAGGAGCACTTGG + Intronic
1085101315 11:73802797-73802819 GCTGAGGTAGGAGGATCACTTGG - Intronic
1085400355 11:76232364-76232386 GCTGAGGTGAGAGCAGGGCGGGG - Intergenic
1085641922 11:78198082-78198104 GCTGAGCCATGATCAGGGCTGGG + Intronic
1085721728 11:78918243-78918265 GCTGTGGTAAGAGAAGGAGTAGG - Intronic
1086398310 11:86440148-86440170 GCTGAGGTAGCAGCAGGAGTAGG + Intergenic
1087200832 11:95342767-95342789 GCTGAGGCATGAGGATCACTTGG - Intergenic
1089385478 11:118064741-118064763 GCTGAGGTAGGAGGATGGCTCGG - Intergenic
1090205021 11:124879305-124879327 GCTGTGCTAGGGGCAGGACTGGG - Exonic
1090603163 11:128393503-128393525 GCTGAGCTTTGAGCTGGAGTTGG + Intergenic
1091394471 12:145371-145393 GCCGAGGTAGGAGGAGCACTTGG - Intronic
1091936141 12:4435816-4435838 GCAGAGGAAAGAGGAGGACTTGG - Intronic
1093023025 12:14220409-14220431 GCTGGGATACGAGGAGGACTAGG + Intergenic
1093144876 12:15553499-15553521 CCTGGGGTAGGAGCACGACTGGG + Intronic
1094127122 12:27034848-27034870 GCTGAGGCATAAGAAGCACTTGG - Intronic
1094191913 12:27706502-27706524 GCTGAGGCAGGAGAACGACTTGG + Intergenic
1094572833 12:31656640-31656662 GATGAGCTATTAGCAGGACTTGG - Intronic
1096132797 12:49173759-49173781 GCTGAGGTAGGAGTATCACTTGG - Intergenic
1097074999 12:56386312-56386334 GCTGAGGTAAGAGAATCACTTGG + Intergenic
1097701968 12:62829601-62829623 GCTGTGGTCGGAGCAGGACTGGG + Intronic
1098075483 12:66725200-66725222 GCTGAGGTAAGAGGATCACTTGG + Intronic
1099197924 12:79640639-79640661 GCTGAGGTAGGAGGATCACTTGG + Intronic
1099332837 12:81312287-81312309 GCTCAGGTATGAGAAAGACATGG + Intronic
1101277740 12:103220774-103220796 GCTGAGGGAGGAGGAGGAATGGG + Intergenic
1101440765 12:104702911-104702933 GCTAAGGCATGAGGAGGACTTGG - Intronic
1101602944 12:106226138-106226160 TCTGTGGTAGCAGCAGGACTCGG - Intergenic
1101986818 12:109453600-109453622 GCTGTGGTCTCAGCAGGATTGGG + Intronic
1102165003 12:110799045-110799067 GCTGAGGCATGAGAATCACTTGG - Intergenic
1103522264 12:121544200-121544222 GCTGAGGTAGGAGGAGTCCTGGG + Intronic
1103543797 12:121685274-121685296 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1103787660 12:123445423-123445445 GCTGAGGCAGGAGCATCACTTGG - Intergenic
1104443046 12:128810875-128810897 CCTGAGGTATGGCCAGGACTTGG + Intronic
1104676435 12:130715002-130715024 GCTGGGCTCTGAGCAGGAGTGGG - Intronic
1105407145 13:20142304-20142326 GCTGATGACTGAGCAGAACTGGG - Exonic
1105910794 13:24864200-24864222 GCTGAGGCAGGAGCAGGGCTAGG + Intronic
1107250345 13:38352195-38352217 GCTGAGGAAGGAGAAGAACTGGG - Intronic
1107459907 13:40591799-40591821 GCTGAGGTATGAGAATTGCTTGG - Intronic
1108210755 13:48137754-48137776 TCTGAGGTGTGAGGAGGAGTTGG - Intergenic
1110724160 13:78800391-78800413 GCTGAGGTAGGAGGATGGCTTGG - Intergenic
1111111387 13:83715005-83715027 GCTGAGGTAGGAGAATCACTCGG - Intergenic
1112991902 13:105524640-105524662 GATGAGGGTTCAGCAGGACTTGG - Intergenic
1113668855 13:112161529-112161551 GCTGAAGTTTGAGCAGGGCCCGG - Intergenic
1113990626 14:16024722-16024744 GCTGAGGGATTTGAAGGACTTGG - Intergenic
1115259099 14:31435109-31435131 GCTGAGGCAGGAGGATGACTTGG - Intronic
1116199323 14:41771053-41771075 GCTGTGGTTTGAGCTGTACTTGG + Intronic
1116317373 14:43415599-43415621 GCTGAGGTAGGAGAATCACTTGG + Intergenic
1117768120 14:59104117-59104139 GCTGAGGTAAGAGAATCACTTGG + Intergenic
1117779534 14:59218031-59218053 GCTGAGGAAGGAGCATCACTTGG + Intronic
1117991995 14:61442836-61442858 GCTGAGGTAGGAGCATCACTTGG + Intronic
1118208818 14:63748315-63748337 GCTGAGGTAGGAGGATTACTTGG - Intergenic
1118436074 14:65771882-65771904 GCTGAGGTAGGAGGATCACTTGG - Intergenic
1118704988 14:68472114-68472136 GGAGAGGTAAGAGCAGGAGTTGG + Intronic
1119945981 14:78694878-78694900 GCTGAGGAATGAGCAGCAGTGGG + Intronic
1120322471 14:82981843-82981865 GCTGAGGTAGGAGAATTACTTGG + Intergenic
1120857478 14:89225203-89225225 GCTGAGGTAGGAGGATCACTTGG + Intronic
1121349626 14:93162917-93162939 GCTGAGGCAGGAGCATCACTTGG + Intergenic
1121756182 14:96404042-96404064 GCTGAGGTATGAGAACCACTTGG + Intronic
1121881595 14:97505771-97505793 GCTGAGGTAGGAGAATCACTTGG + Intergenic
1121985027 14:98497032-98497054 GCTGAGGTAGGAGAATCACTTGG + Intergenic
1122160418 14:99780329-99780351 GCTTAGGAATGGGCAGGACCAGG - Intronic
1122161793 14:99790435-99790457 GCTGAGGTGCGAGGACGACTTGG - Intronic
1122961348 14:105094975-105094997 GCTGAGGCATGAGAATCACTTGG - Intergenic
1123095689 14:105766046-105766068 CCTGAGGGGTGAGCAGGCCTCGG - Intergenic
1123873749 15:24602552-24602574 GCTGAGGTAGGAGAATCACTTGG - Intergenic
1125017418 15:34949864-34949886 GCTGAGGTAGGAGGATCACTTGG + Intronic
1125901804 15:43355146-43355168 GCTGAGGTAGGAGGATGGCTTGG + Intergenic
1126748489 15:51851168-51851190 GCTGAGGTAAGCTGAGGACTGGG + Intronic
1127019427 15:54729429-54729451 GATTAGGTATGACAAGGACTAGG + Intergenic
1127310937 15:57751940-57751962 GCTGAGGTTTGAGAATCACTTGG + Intronic
1127709176 15:61578635-61578657 GCTGGGGTATGACCAGGTGTAGG + Intergenic
1129017668 15:72482938-72482960 GCTGAGGTAAGAGGATCACTTGG - Intronic
1129643693 15:77410231-77410253 GCTGAGGTAGGAGAATCACTTGG - Intronic
1129784078 15:78296606-78296628 GCTGAGGTGGGAGCAAGACTTGG - Intronic
1130754315 15:86746381-86746403 CCTCAGGAATGACCAGGACTTGG - Intronic
1130831166 15:87602343-87602365 GCTGTGGTAGCAGCAGGATTAGG + Intergenic
1131408904 15:92189500-92189522 GCTGAGGTCTAAGCATGGCTGGG + Intergenic
1132647239 16:1004735-1004757 GCTGAGGTAGGAGGATCACTGGG + Intergenic
1133325820 16:4941692-4941714 GCTGAGGTAGGAGAATGGCTGGG - Intronic
1134102138 16:11460027-11460049 GCTCTGGCATGAGGAGGACTCGG - Exonic
1134129293 16:11637779-11637801 GCTGAGGTGGGAGCATCACTTGG + Intergenic
1134537741 16:15040257-15040279 GCTGAGGCTCGAGCTGGACTCGG + Intronic
1135733432 16:24912936-24912958 GCAGAGCTAAGAGCAGGACAGGG + Intergenic
1135792416 16:25409339-25409361 CATAATGTATGAGCAGGACTGGG + Intergenic
1135984746 16:27175856-27175878 GCTGAGGAATTAGGAGGCCTGGG + Intergenic
1137307402 16:47216759-47216781 GCTGAGGCATGAGAATCACTTGG - Intronic
1137649521 16:50107971-50107993 GCTGAGGCATGAGAATCACTTGG + Intergenic
1137692974 16:50441947-50441969 GCTGAGGGCTGAGCAGAAGTTGG + Intergenic
1137724697 16:50649394-50649416 GCTGAGCTAGGAGCAGGTTTTGG - Intergenic
1138167502 16:54816941-54816963 GCTGAGGTGGGAGCATCACTTGG - Intergenic
1138182746 16:54953355-54953377 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1138389571 16:56660469-56660491 GCAGAGTCATGAGAAGGACTGGG + Intronic
1138477214 16:57278783-57278805 AGTGAGGTGTGAGCAGGGCTTGG - Intronic
1139044451 16:63039809-63039831 GCTGAGGCATGAGAATCACTTGG - Intergenic
1139530966 16:67542602-67542624 GCTGTGGTATGGGTAGGGCTTGG - Exonic
1139823490 16:69739135-69739157 GCTGAGGTAGGAGGATCACTTGG - Intergenic
1140271851 16:73473104-73473126 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1141717920 16:85737461-85737483 GCTGAGGCATGAGGATCACTTGG + Intronic
1141741194 16:85894237-85894259 GCTGAGTTACAAGCAGCACTTGG - Intergenic
1141986701 16:87585058-87585080 GCTGAGGGATCAGCATCACTAGG + Intergenic
1142077813 16:88130604-88130626 GCTGAGGTAGGAGAATCACTTGG + Intergenic
1143028189 17:3953191-3953213 GCTGAAGTCTGAGCAGGGCAGGG + Intronic
1143094390 17:4469517-4469539 GCTGAGGCATGAGAATCACTTGG + Intronic
1143520807 17:7443212-7443234 GCAGGGGTGAGAGCAGGACTGGG - Exonic
1144407431 17:14965803-14965825 ACTGAGGGATGACCAGGATTTGG + Intergenic
1144509382 17:15862313-15862335 GCTGAGGCATGAGAATCACTTGG - Intergenic
1144573175 17:16413248-16413270 GATGATGGATGAGCAGGAGTTGG + Intergenic
1144656088 17:17037717-17037739 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1144765243 17:17728969-17728991 GCTGAGGTCCGAGCAGCACAGGG + Intronic
1144937829 17:18914355-18914377 GCTGAGGTAGGAGAATGGCTTGG - Intronic
1145015071 17:19391223-19391245 GCTGAGGTGTAAGCAGGAGATGG - Intergenic
1146008536 17:29177498-29177520 GCCGAGGTAGGAGCTGGATTGGG - Intronic
1146368170 17:32246139-32246161 GCTGAGGCATGAGAATCACTTGG + Intronic
1147401580 17:40183402-40183424 GCTGGGGCATGAGGAGGTCTTGG + Intronic
1147817049 17:43217686-43217708 GCTCAGGTATGAACAGGTCAGGG - Exonic
1148860213 17:50600690-50600712 ACTGGAGTATGAGCAGGACCAGG - Intronic
1150353522 17:64464214-64464236 GCTGAGGCAGGAGGAGGCCTGGG - Intronic
1150432347 17:65128474-65128496 GCTGAGGTAGGAGAATCACTTGG - Intergenic
1151228632 17:72665620-72665642 GCTGAGGTAGGAGAATCACTTGG - Intronic
1152607720 17:81301400-81301422 GATGAGGTGTGAGCAGGAGGAGG + Intergenic
1155006398 18:21733493-21733515 GCTGAGGTAGGAGAATGGCTTGG - Intronic
1155133092 18:22958643-22958665 GCTGAGGTGTGAGGATCACTTGG - Intronic
1155283768 18:24268213-24268235 GCTGAGGTAGGAGGATCACTTGG - Intronic
1155340274 18:24806922-24806944 GCTGAGGTAGGAGGATCACTCGG + Intergenic
1155938049 18:31774840-31774862 GCTTAGGAATGAGCATTACTAGG + Intergenic
1155970424 18:32077886-32077908 GCTGAGGTAGGAGGATCACTTGG - Intergenic
1156454462 18:37285194-37285216 TCAGAGGGATGGGCAGGACTGGG - Intronic
1157423936 18:47569298-47569320 GCTGAAGGAGGAGAAGGACTGGG - Intergenic
1158684691 18:59602698-59602720 CTTGAGGCATGAGTAGGACTTGG + Intronic
1160367307 18:78337440-78337462 GCTGAGGTAGGAGCAGCAGGAGG - Intergenic
1160498798 18:79392217-79392239 GCTGAGGCATGAGGATCACTTGG + Intergenic
1160736420 19:664532-664554 GCTGAGGGATGAATAGGATTTGG + Intergenic
1161332358 19:3694412-3694434 ACTGAGGACAGAGCAGGACTGGG - Intronic
1161601436 19:5186154-5186176 GCTGAGGTAGGAGGATCACTTGG - Intronic
1162310863 19:9906478-9906500 GCTAAGGTTTGAGCAGCTCTTGG - Intronic
1162387381 19:10368038-10368060 GAGCAGGTATGAGCAGGGCTGGG - Exonic
1162927874 19:13939095-13939117 GCTGAGGTCTGGGCAGGAGAAGG - Intronic
1163418714 19:17202412-17202434 GCTGTGGTATGGGCAGGGCATGG - Intronic
1163434736 19:17288713-17288735 GATGAGGCGTGAGCAGGGCTGGG + Intergenic
1163778972 19:19235674-19235696 GCTGAGGTAGGAGAATCACTTGG - Intronic
1164263336 19:23589326-23589348 GCTGAGGCAGGAGCATTACTTGG - Intronic
1164696459 19:30248327-30248349 GCTGAGGCATGAGAATCACTTGG - Intronic
1165033526 19:33015948-33015970 GCTGAGGTAGGAGAATCACTTGG + Intronic
1165081673 19:33310448-33310470 GCTGAGGTAGGAGGATCACTCGG + Intergenic
1166037651 19:40180786-40180808 GCTGAGGCATGAGAATCACTTGG - Intergenic
1166486500 19:43218489-43218511 GCTGAGGCATGAGAATCACTTGG + Intronic
1166530083 19:43537185-43537207 GCTGAGGTATGAGAATCGCTTGG + Intergenic
1166644196 19:44519112-44519134 GCTGAAGGATGAGTAGGAGTAGG - Intronic
1166663433 19:44662353-44662375 GCTGAGGTGGGAGGATGACTTGG - Exonic
1167305871 19:48709053-48709075 GCTGAGGTGGGAGGAGCACTTGG + Intergenic
926559974 2:14406102-14406124 GCTGAGAAATGGGCAGGACCTGG - Intergenic
926735385 2:16069842-16069864 GCTGAGGGAACAGCAGGCCTCGG + Intergenic
927113731 2:19882478-19882500 GAGGAAGTATGAGTAGGACTGGG - Intergenic
929200145 2:39226864-39226886 GCTAAGGCATGAGCATCACTTGG - Intronic
929735289 2:44541669-44541691 GCTGAGGTAAGAGGATCACTGGG + Intronic
929823619 2:45292826-45292848 GCTGAGGTTTGAGAAGGAGGGGG - Intergenic
929938574 2:46313271-46313293 GCTGAGGGATGAGCAAGCTTAGG - Intronic
930439508 2:51389166-51389188 GCTGAGGCATGAGAATCACTTGG - Intergenic
930751443 2:54938417-54938439 ACTGAGGCATGAGAGGGACTTGG - Intronic
930781556 2:55229049-55229071 GCTGAGGTATGAGAATCATTTGG + Intronic
931357724 2:61552045-61552067 GCTGAGGTATGAGAATCCCTTGG - Intergenic
931533152 2:63240275-63240297 GCTGAGGTAGGAGGATCACTTGG - Intronic
931598282 2:63975143-63975165 GCTGAGGCATGAGAATCACTTGG - Intronic
932026890 2:68142984-68143006 GCTGAGGTAGGAGGATCACTTGG - Intronic
933459800 2:82567735-82567757 GCTGAGACAGGAGCATGACTTGG - Intergenic
934849681 2:97690029-97690051 GCTGAGACATGAGCATCACTTGG + Intergenic
935266120 2:101395804-101395826 GCTGTGGCATGAGCTGGATTTGG - Intergenic
936559240 2:113522465-113522487 GCTGAGGTAGGAGGATCACTTGG - Intergenic
936812919 2:116423581-116423603 GCTGAGGCATGAGAATCACTTGG - Intergenic
936986535 2:118316248-118316270 GCTGAGGCAGGAGGATGACTTGG - Intergenic
937321599 2:120964216-120964238 GCTGAGGTCTGAGCAGGCAGAGG + Intronic
937717903 2:125055859-125055881 GCTGGCCTATGAGCAGCACTTGG - Intergenic
937970601 2:127546099-127546121 GGTGAGGGATGAGTAAGACTTGG - Intronic
938403389 2:131012678-131012700 GCTGAGGCATGAGAATCACTGGG - Intronic
939365622 2:141226833-141226855 GCAGGGGTGTGAGCAGGGCTGGG - Intronic
940360284 2:152789625-152789647 GCTGAGGTAGGAGTATCACTTGG + Intergenic
940364731 2:152835446-152835468 GCTGAGGCATGAGAATCACTTGG + Intergenic
940948434 2:159645170-159645192 GCTGAGGTGTGAGGATCACTTGG + Intergenic
941948255 2:171123709-171123731 GCTGAGGTAGGAGAAGCGCTTGG + Intronic
942219647 2:173756665-173756687 GCTGAGGTAGGAGGATCACTTGG + Intergenic
944428910 2:199612351-199612373 GCTGAGGTAGGAGGATCACTTGG - Intergenic
944624068 2:201552093-201552115 GCTGAGGTGGGAGAAGTACTTGG - Intronic
946845651 2:223856683-223856705 CCTGAGGCCTCAGCAGGACTTGG - Intronic
948406042 2:237720345-237720367 GCTGAGGCATGAGAATCACTTGG - Intronic
948748625 2:240113767-240113789 GCTTAGGTGTCAGCAGGAATAGG + Intergenic
1170986416 20:21263531-21263553 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1173785477 20:45790043-45790065 GCTGAGGTATGAGCAGGACTAGG + Intronic
1174142322 20:48424535-48424557 GGTGAGAGATGACCAGGACTTGG - Intergenic
1174347562 20:49941788-49941810 GCTGAAGTTAGAGCATGACTAGG + Intronic
1174359367 20:50018190-50018212 GCAGAGGTGAGAGCAGGACCAGG - Intergenic
1174367261 20:50064056-50064078 GCTGAGGTGGGAGCATCACTTGG + Intergenic
1174369090 20:50074248-50074270 GCTGAGGCAGGAGAATGACTTGG - Intergenic
1175215204 20:57388974-57388996 GCTGAGGTAGGAGGATGGCTTGG + Intergenic
1175923000 20:62458767-62458789 GCTGAGGTGTGGCCAGGGCTGGG + Intergenic
1176289534 21:5036834-5036856 TCTGTGGTATGAGCAGGAACAGG + Intronic
1177151702 21:17461815-17461837 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1177152147 21:17465820-17465842 GCTGAGGCATGAGAATCACTTGG - Intergenic
1177347648 21:19894180-19894202 CCTGAGGGATGAGGAGGACATGG - Intergenic
1177829411 21:26120805-26120827 TGTGAGGTATGAGCAGGAACGGG - Intronic
1177890045 21:26794218-26794240 GCTGAGGCAGGAGAATGACTTGG - Intergenic
1178274754 21:31227054-31227076 GCTGAGGTATGAGAATTGCTTGG - Intronic
1178281448 21:31286327-31286349 GCTGAGGCAGGAGGACGACTTGG + Intronic
1178411246 21:32365349-32365371 GCTGAGGTGTGAGGAACACTTGG + Intronic
1179547581 21:42123041-42123063 GCTGAGGTACAACGAGGACTCGG - Exonic
1179867696 21:44226753-44226775 TCTGTGGTATGAGCAGGAACAGG - Intronic
1180316644 22:11282804-11282826 GCTGAGGGATTTGAAGGACTTGG + Intergenic
1180954181 22:19734150-19734172 GCTGCTGTCTGAGCAGGGCTGGG + Intergenic
1181515576 22:23409851-23409873 GAGGAGGAATGAACAGGACTGGG - Intergenic
1181560606 22:23697488-23697510 GCTGAGGTGTGGGCTGAACTGGG + Intronic
1181590710 22:23883247-23883269 GCTGAGGTGGGATCAGGAGTTGG + Intronic
1181920373 22:26315821-26315843 GCTGAGGTAGGAGAATCACTTGG + Intronic
1182149000 22:28015520-28015542 GCTGAGGCAGGAGGAGCACTTGG - Intronic
1183105685 22:35613593-35613615 GCTGAGGTAGGAGGATCACTTGG - Intronic
1183174312 22:36211681-36211703 TCTGATGTAGGAGCTGGACTGGG + Intergenic
1184445521 22:44544783-44544805 GCTCAGGTATCAGCAGGACATGG - Intergenic
1184988883 22:48154314-48154336 GCTGAGGTATCAGCAGGGGATGG - Intergenic
949795576 3:7846790-7846812 GCTGAGGTAAGAACAGCAGTTGG + Intergenic
951329189 3:21344612-21344634 GCTGAGGTAGGAGAATCACTTGG + Intergenic
952005778 3:28840995-28841017 GCTGATCTATCAGCAGGACTCGG + Intergenic
952190755 3:31020727-31020749 GCTGAGGGATGAGGAGGAGGAGG + Intergenic
952777889 3:37064179-37064201 GATGGGGTAAGAGCAGGACTGGG + Intronic
954290107 3:49645180-49645202 GATGAGGTAGGACCAGGACTAGG - Intronic
954472157 3:50707335-50707357 GCTGAGGCATGAGAATCACTTGG + Intronic
954687722 3:52379676-52379698 GCTGAGGCATGAGGAGGCCCAGG + Intronic
955308017 3:57853839-57853861 GCTGAGGCAGGAGAATGACTTGG + Intronic
955592471 3:60552459-60552481 GGTGAGGAATGTGGAGGACTTGG - Intronic
955996143 3:64682817-64682839 GATAAAGTATGAGCAGCACTAGG + Intronic
957578526 3:82040101-82040123 GCTGAGGTAGGAGGATTACTTGG + Intergenic
957680908 3:83433150-83433172 GCTGAGGTAGGAGAATCACTGGG - Intergenic
959039049 3:101399723-101399745 GCTGAGGTAGGAGGATTACTTGG - Intronic
960457297 3:117888235-117888257 GATGAGGAATCACCAGGACTGGG - Intergenic
960689696 3:120332847-120332869 GCTGAGGTAAGAGGATGGCTTGG - Intronic
961085891 3:124067217-124067239 TCTGAGGTCTGAGTAGGATTAGG - Intergenic
961151956 3:124646488-124646510 GCTGAGGTAGGAGAATCACTTGG - Intronic
963811303 3:149779271-149779293 GCTGAGGTAGGAGGATCACTTGG - Intronic
965526380 3:169723370-169723392 GCTGAGGTGGGAGGATGACTTGG + Intergenic
965594892 3:170400908-170400930 GCTGAGGTGGGAGGATGACTGGG - Intergenic
965903118 3:173668721-173668743 GCTGAGGCATGAGCATTGCTGGG - Intronic
967512519 3:190328179-190328201 GCTGAGGTAGGAGAATCACTTGG + Intronic
967784397 3:193474434-193474456 GCTGAGGTAGGAGGATTACTTGG + Intronic
968678097 4:1896466-1896488 GCTGAGGTGTGAGGATGGCTTGG - Intronic
968841995 4:3014394-3014416 GCTGAGGTAGGAGGATCACTTGG - Intronic
968870854 4:3241455-3241477 GCTGATGTAGGAGCTGGATTTGG + Exonic
969281634 4:6174742-6174764 GCTGAGGTATGAGCAGGGAGGGG - Intronic
969519844 4:7669799-7669821 GCTGAATTATGAGCAGTCCTGGG + Intronic
969660396 4:8524049-8524071 ACTGAGGAATGAACAGGAGTTGG + Intergenic
970120506 4:12747957-12747979 GCTGAGGCAGGAGAATGACTTGG - Intergenic
970171651 4:13296619-13296641 GCTGAGGTAGGAGAATCACTTGG - Intergenic
970388099 4:15577091-15577113 GCTGAGGTAGGAGCATCACTTGG - Intronic
970391765 4:15619068-15619090 GCTGAGGTAAGAGGATCACTAGG + Intronic
971049507 4:22845164-22845186 GCTGAGGCATGAGAATCACTTGG - Intergenic
971177538 4:24294106-24294128 GCTTTGGTATGAGCTCGACTTGG - Intergenic
971337228 4:25734666-25734688 GCTGAGGAATGAGAATCACTTGG - Intergenic
973761075 4:54116359-54116381 GCTGAGGAAGGAGAATGACTTGG - Intronic
974379300 4:61117889-61117911 GCTGAGGTAGGAGGATCACTTGG + Intergenic
975333243 4:73143838-73143860 GCTGAGGTAGGAGAAGCACTTGG - Intronic
975547985 4:75580170-75580192 GCTGAGGCATGAGGATCACTTGG + Intronic
976947162 4:90784507-90784529 GCTGTGGAATGAGAAGGAGTGGG + Intronic
978126547 4:105143238-105143260 GCTGAGGTAGGAGGAGCACGAGG + Intergenic
978184573 4:105841748-105841770 GCTGAGGCATGAGAATCACTGGG + Intronic
978457475 4:108909914-108909936 GAGGAGCTATGAGCAGGGCTTGG - Intronic
978640732 4:110868149-110868171 TCTGAGGTATGATCAGAATTTGG - Intergenic
978799033 4:112737511-112737533 TCTGAGATTTGTGCAGGACTTGG + Intergenic
981066816 4:140494631-140494653 GCTGGGGTAGGAGCAGGTTTGGG - Intronic
984064998 4:175036838-175036860 GCTGAGGTATGAGAATCACTTGG - Intergenic
984277042 4:177623737-177623759 GCTGAGGTAGGAGGATGGCTTGG - Intergenic
984872897 4:184342905-184342927 GCTGAGGTAGGAGGATCACTTGG + Intergenic
985727044 5:1522100-1522122 GCTGGGGCAGGAGCAGGGCTGGG + Intronic
985991303 5:3564115-3564137 GCCGAGGTATGAGAAGTACCTGG + Intergenic
986689720 5:10304267-10304289 GCTGAGCTAGGAGGAGCACTTGG + Intronic
988075413 5:26347293-26347315 GCTGAGGTAGGAGAATCACTTGG - Intergenic
988522996 5:31963089-31963111 TCAGAGGTATGAGCAGGTATGGG - Intronic
988734968 5:34011281-34011303 GCTGAGGTCTGAGGATCACTTGG + Intronic
988961836 5:36378608-36378630 GCTGAGGCAGGAGCAGGAGAGGG - Intergenic
989036460 5:37177845-37177867 GATTAGGTCAGAGCAGGACTGGG - Intronic
989805604 5:45599980-45600002 GCTGAGTTATGAACAGGCCTAGG - Intronic
991251152 5:64562774-64562796 GCTGGTGGGTGAGCAGGACTGGG + Intronic
991259583 5:64652575-64652597 GCTGAGGTAGGAGGATCACTTGG + Intergenic
991522814 5:67519325-67519347 GATGATGGATGACCAGGACTGGG - Intergenic
991710802 5:69406599-69406621 GCTGAGGTAGGAGGATCACTTGG - Intronic
992177805 5:74167585-74167607 GTTGAGTTATGAGCTGCACTGGG - Intergenic
992382185 5:76248716-76248738 GCTGAGGTGGGAGGATGACTTGG - Intronic
992543734 5:77789545-77789567 GCTGAGGTAGGAGGATGGCTTGG + Intronic
992590788 5:78294331-78294353 CCTGAGGTCTGAGCAGGGCAGGG - Intronic
992812622 5:80404973-80404995 GCTGAGGTAGGAGGATCACTTGG + Intergenic
992972544 5:82077221-82077243 GCTGAGGTAGGAGGATCACTTGG + Intronic
994941653 5:106331120-106331142 GCTGAGGTAGGAGAATCACTTGG - Intergenic
995304778 5:110631947-110631969 GCTCTGGTATTAGCAGGACCAGG - Intronic
995958928 5:117815557-117815579 GCTGAGGTAGGAGGATCACTTGG - Intergenic
997568198 5:134905292-134905314 GCTGAGGGACCAGCGGGACTGGG + Intronic
997898428 5:137740971-137740993 GCTGGGGTGTGGGAAGGACTGGG - Intergenic
998169437 5:139863923-139863945 GCTGTGGTCTGAGGAGTACTGGG + Intronic
998476420 5:142426185-142426207 GTTGAGGTCTGAGCAGGCCACGG - Intergenic
998646668 5:144069556-144069578 TCTGAGGTATGAGAATCACTTGG + Intergenic
999444787 5:151630714-151630736 GCTGAGGCATGAGAATCACTTGG - Intergenic
999871708 5:155758257-155758279 TCTGAGTTATGAGCAGAACCAGG + Intergenic
1001360353 5:171078260-171078282 GCTGAGGCATGAGAATCACTTGG - Intronic
1001537449 5:172508246-172508268 ACTGAGGTGTCAGCAGGACCAGG - Intergenic
1001849764 5:174953274-174953296 GCTGAGGCACGAGAATGACTTGG - Intergenic
1002280792 5:178129034-178129056 GCTGAGGCCTGAGGAGGAGTGGG + Intergenic
1002474980 5:179459826-179459848 GCTGGGGCACCAGCAGGACTCGG - Intergenic
1002693904 5:181071312-181071334 GCTGAGGAATAAGGAGGACTTGG - Intergenic
1004713058 6:18190798-18190820 GCTGAGGCATGAGAATCACTTGG + Intronic
1004980282 6:21015846-21015868 GCTGAGGCATGAGAATCACTTGG + Intronic
1007612764 6:43161006-43161028 GCTGAGGTCTGAGCAGGGCCTGG + Exonic
1008560883 6:52723600-52723622 GCTGAGGCATGAGAATCACTTGG - Intergenic
1009312038 6:62167140-62167162 CCTGAGGTATGAGAAGGAAAGGG + Intronic
1010168035 6:72940438-72940460 GCTGGGGCATGAGTAGGGCTGGG - Intronic
1010436214 6:75834330-75834352 GCTGAGGTAGGAGGATCACTTGG - Intronic
1011600616 6:89056754-89056776 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1011646817 6:89467105-89467127 GCTGAGGCAGGAGTAGTACTTGG + Intronic
1012449582 6:99340766-99340788 GCTGAGGCAGGAGAAGTACTTGG - Intronic
1015837084 6:137432129-137432151 GCTGAGCTCTGAGCAGTCCTGGG - Intergenic
1015936069 6:138406929-138406951 GCTGAGGTAGGAGGATCACTTGG + Intronic
1018008096 6:159642058-159642080 CTTGAGGAATGAGCACGACTTGG + Intergenic
1018700650 6:166423451-166423473 GCTGAGGACTGAGCAGGAGAGGG + Intronic
1018784000 6:167093895-167093917 GGTGAGCTATGAGCAGGCCGGGG - Intergenic
1019519290 7:1453443-1453465 ACGGAGGTGTGAGCAGGGCTGGG - Intronic
1020067999 7:5204365-5204387 GCTGAGGTAGGAGAATCACTTGG + Intronic
1020833069 7:13114901-13114923 GCTGTGGCATGAGCAAGTCTTGG - Intergenic
1021781395 7:24110127-24110149 GCTGTGGCATGACCAGAACTGGG - Intergenic
1022626812 7:32045081-32045103 GCTAATGTATCAGCAGGAGTCGG - Intronic
1022763469 7:33382358-33382380 GCTGAGGCATGAGAATCACTTGG + Intronic
1022792436 7:33702405-33702427 TCTGAGGTATGAGCTGGAATGGG + Intergenic
1022819389 7:33944263-33944285 GCTGAGGCATGAGAATCACTTGG - Intronic
1022948979 7:35317461-35317483 GCTGATGGATGAGCTGGACTTGG + Intergenic
1022965150 7:35465679-35465701 GCTGAAGTGGGAGCAGGAGTGGG + Intergenic
1023119042 7:36890937-36890959 CCTGAGGTTGGAGCAGGTCTGGG - Intronic
1024579018 7:50787086-50787108 GCTCAGCTATGAGCAGCATTAGG + Intronic
1026107208 7:67430711-67430733 GCTGAGGCATGAGAATCACTTGG - Intergenic
1026139549 7:67693738-67693760 GCTGAGGTAGGAGAATGGCTTGG + Intergenic
1026293260 7:69028067-69028089 GCTGAGGTAGGAGGACCACTTGG - Intergenic
1028397102 7:90382350-90382372 GCTGAGGTAGGAGCATTGCTTGG - Intronic
1029300520 7:99579458-99579480 GCTCTGGTATGAGCAGGCCAGGG + Intronic
1029936690 7:104432480-104432502 GGTGAGAAAGGAGCAGGACTTGG - Intronic
1031512995 7:122671828-122671850 GCAGAGGTGTGAGCAAAACTAGG + Intronic
1031519385 7:122744807-122744829 GCTGAGGTTTGAATCGGACTGGG - Intronic
1031658997 7:124397152-124397174 GCTGAGGAAGGAGCAGGTTTGGG + Intergenic
1032124087 7:129179373-129179395 GCTGAGGTAGGAGAATCACTTGG - Intergenic
1032199388 7:129808665-129808687 GCTGAGGTAAGAGGATCACTTGG + Intergenic
1032233890 7:130102724-130102746 GCTGAGGCATGAGAATCACTTGG + Intronic
1032699929 7:134370598-134370620 GCTGGGGAATGGGCAGGAGTGGG + Intergenic
1034130779 7:148714983-148715005 GCTGAGGCAGGAGGAGGGCTTGG - Intronic
1034262869 7:149767649-149767671 GCTGAGGTAAGAGGATCACTTGG - Intronic
1034401296 7:150863386-150863408 ACTGAGCTCTGAGCAGGGCTGGG - Intergenic
1034633701 7:152550716-152550738 AATGAGGAATGAGCAGGCCTGGG - Intergenic
1035380766 7:158439250-158439272 GCTGAGGCATGCGCAGGAGGTGG - Intronic
1035660702 8:1345644-1345666 CCTGAGGGATGGGCAGGACAGGG + Intergenic
1035714174 8:1741177-1741199 CCTGAAGGATGAGGAGGACTTGG + Intergenic
1036625467 8:10467636-10467658 GCTGAGGTAGGAGGATGACTTGG + Intergenic
1036712009 8:11085788-11085810 GCTGGGGTATGAGGAGGAAGGGG - Intronic
1037920823 8:22804229-22804251 GCTGAGGCAGGAGGATGACTTGG + Intronic
1037933322 8:22897756-22897778 GCTGAGGGAAGAGCAGGTTTAGG - Intronic
1038003903 8:23413890-23413912 GCTGAGGTGGGAGCATCACTGGG - Intronic
1038057208 8:23871725-23871747 GCTGAGGTAAGAGCAGTACCAGG - Intergenic
1038219560 8:25594522-25594544 GCTGAGGCATGAGAATCACTTGG - Intergenic
1038264769 8:26030009-26030031 GCTGAGGTAGGAGGATCACTTGG - Intronic
1038473704 8:27846545-27846567 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039196136 8:35033726-35033748 GCTGAGGTAGGAGGATTACTTGG + Intergenic
1039231661 8:35455376-35455398 GCTGAGGCATGAGAATCACTTGG - Intronic
1039254769 8:35706885-35706907 TCTGATGTATGAGAATGACTTGG - Intronic
1039814963 8:41085388-41085410 GCTGAGGCATGAGAATCACTTGG + Intergenic
1040318235 8:46276169-46276191 GGTGAGGGCTGAGCAGGAGTGGG - Intergenic
1040562047 8:48531685-48531707 GCTGAGGCATGAGAATCACTTGG - Intergenic
1041595627 8:59647518-59647540 GCTGAGGCATGACCAAGGCTGGG - Intergenic
1042347344 8:67741040-67741062 CCATAGGTATGAGCAGGGCTGGG - Intronic
1042923635 8:73944316-73944338 GCTGAGGTATGATGAACACTTGG - Intronic
1043407517 8:79953071-79953093 TCTGAGGTCAGAGCAGGATTAGG - Intronic
1045414189 8:101950333-101950355 GCTCAGGAATTAGCAGGACCAGG + Intronic
1045563413 8:103288550-103288572 GCTGAGGCAGGAGGATGACTTGG - Intergenic
1047620842 8:126606280-126606302 ACTGAGATCTGAGCAGGATTTGG + Intergenic
1048503900 8:135003615-135003637 ACTGAGGTCACAGCAGGACTGGG - Intergenic
1048708894 8:137185858-137185880 GCTGAGGCATGAGAATCACTTGG + Intergenic
1048910760 8:139132558-139132580 GCTGGGGTAAGAGCATAACTTGG + Intergenic
1049389193 8:142359373-142359395 GCTGAGGTCAGGGCAGGGCTGGG - Intronic
1049701700 8:144017477-144017499 TGGGAGGTATGAGCAGGGCTTGG + Intronic
1049716931 8:144097395-144097417 GCTGAGGCCTGAACAGGCCTGGG - Exonic
1049814987 8:144594783-144594805 GCTGAGGCATGAGAATCACTTGG + Intronic
1049931659 9:463155-463177 GCTGAGGTAGGAGGATCACTGGG + Intronic
1050169651 9:2802177-2802199 GCTTTGGTATGTGCAGGACTAGG - Intronic
1050465354 9:5917247-5917269 GCTGAGGTATGACAAGGACAGGG + Intronic
1051233934 9:14979066-14979088 GCTCTGGTATGAGCAGGCCAGGG - Intergenic
1051587780 9:18745498-18745520 GCTGACGTCTGGGCAGGAATTGG - Intronic
1053442235 9:38126025-38126047 AATGAGGTCTGAGAAGGACTCGG - Intergenic
1054452887 9:65412855-65412877 CCTGGGGTATGGGAAGGACTAGG - Intergenic
1055079842 9:72258211-72258233 GCTGAGGTGTGAGGATCACTTGG + Intergenic
1055859981 9:80737804-80737826 GCTGAGGACTGAGCAGCACACGG + Intergenic
1056080694 9:83091453-83091475 GCTGAGGCAGGAGCAACACTGGG + Intergenic
1057104346 9:92397424-92397446 GCTGAGGTGGGAGCATCACTTGG - Intronic
1057191866 9:93092859-93092881 ACTGAGGTGGGAGCAGGGCTGGG + Intergenic
1057407647 9:94788168-94788190 GCTGAGGTAGGAGGATCACTTGG - Intronic
1059191084 9:112327102-112327124 GCTGAGGTAGGAGGATCACTTGG + Intronic
1060084315 9:120682815-120682837 GCTGAGGTGGGAGCATCACTTGG - Intronic
1060134314 9:121136939-121136961 GCTGATGGATGAGTAGGATTTGG + Intronic
1060923267 9:127437617-127437639 ACTGAGGTGTCAGCAGGCCTGGG + Intronic
1061129412 9:128700028-128700050 GCTGAGGCATGAGAATCACTTGG + Intergenic
1061197054 9:129112094-129112116 GATGAGGGGTGAGCAGGACGCGG - Intronic
1061383668 9:130275888-130275910 CGTGAGGTGTGAGCTGGACTAGG + Intergenic
1061400960 9:130368160-130368182 CCTGAAGGATGAGCAGGAATTGG + Intronic
1061864931 9:133487323-133487345 GCTGGGGTATGACCAGGAATGGG + Intergenic
1061905637 9:133695341-133695363 GCTGAGGCATGAGAATCACTTGG + Intronic
1062264010 9:135678539-135678561 GCTGAGGTATGACCGTGGCTGGG + Intergenic
1203364949 Un_KI270442v1:248739-248761 GCTGAGGGATTTGAAGGACTTGG + Intergenic
1185480026 X:439059-439081 GCTGAGGCAGGAGAATGACTTGG - Intergenic
1185625336 X:1477087-1477109 GCTGAGGCAGGAGAAGCACTTGG + Intronic
1186132716 X:6485996-6486018 GCTGAGGCATGAGAATCACTTGG - Intergenic
1187290923 X:17952492-17952514 ACTGAGGTATAGGCAGGGCTGGG + Intergenic
1187525334 X:20048827-20048849 GCTGAGGTGAGAGGAGGGCTTGG + Intronic
1188395206 X:29674324-29674346 GCTGAGGTAGGAGGATCACTTGG + Intronic
1189296332 X:39920888-39920910 GCTGAGGCAGGAGAATGACTTGG + Intergenic
1189343510 X:40222586-40222608 GCTGAGGTGTGAGGATCACTTGG + Intergenic
1190291438 X:48995395-48995417 TCTGAACTAGGAGCAGGACTGGG + Intronic
1195101915 X:101563042-101563064 GCTGTGGTATTAGCAGGAAAGGG + Intergenic
1196680328 X:118463590-118463612 GCTGAGGTGGGAGCATCACTTGG - Intergenic
1196947354 X:120841062-120841084 TCTGAGGTAAGAGAAGCACTTGG + Intergenic
1197620302 X:128740483-128740505 GATGAGGGATGATCATGACTTGG - Intergenic
1197990386 X:132311051-132311073 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1198089728 X:133315854-133315876 GCTGGGGTAAGAGCAGGGGTAGG + Intronic
1198408975 X:136346701-136346723 GCTGAGGAATGAGCAGCTGTAGG - Exonic
1198755925 X:139982539-139982561 GCTGAGGGATGAGAATCACTTGG - Intergenic
1198929485 X:141838411-141838433 GCTGAGGTGGGAGCACCACTGGG - Exonic
1199731587 X:150638157-150638179 ACTGTGGGAAGAGCAGGACTGGG + Intronic
1201481716 Y:14446714-14446736 GCTGAGGTAGGAGGATCACTTGG + Intergenic
1201901925 Y:19052218-19052240 GCTGAGTTATGAGAATCACTTGG + Intergenic
1202375284 Y:24229803-24229825 GCTGAGGTAAGAGGATCACTTGG - Intergenic
1202495496 Y:25440317-25440339 GCTGAGGTAAGAGGATCACTTGG + Intergenic