ID: 1173785788

View in Genome Browser
Species Human (GRCh38)
Location 20:45792016-45792038
Sequence TGGCGACGCCGAGCAGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173785785_1173785788 -10 Left 1173785785 20:45792003-45792025 CCATGGGAGCCACTGGCGACGCC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 83
1173785783_1173785788 -1 Left 1173785783 20:45791994-45792016 CCGGGGGCGCCATGGGAGCCACT 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 83
1173785771_1173785788 30 Left 1173785771 20:45791963-45791985 CCGGTGACAGAGTCCAGCGGAGT 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 83
1173785777_1173785788 17 Left 1173785777 20:45791976-45791998 CCAGCGGAGTTGTGGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 177
Right 1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173785788 Original CRISPR TGGCGACGCCGAGCAGCCGC GGG Exonic
900086902 1:902987-903009 TGAAGACGCCGCGCAGCCGGCGG - Intergenic
904882660 1:33712431-33712453 TGGCGACTGGGAGCAGCCCCCGG + Intronic
905685145 1:39902236-39902258 TGGCACCGCCAAGCGGCCGCCGG - Intronic
905803869 1:40862192-40862214 TCCCGCCGCAGAGCAGCCGCTGG - Exonic
906322765 1:44827178-44827200 TGGAGACGCCCAGGAGCCTCTGG - Exonic
906462223 1:46043524-46043546 TGGAGAGGCCGAGCAGCAGCCGG - Exonic
919892088 1:201982885-201982907 GGGCGCCGCCGAGCTGCGGCTGG + Exonic
924727218 1:246682086-246682108 AGGCGCAGCCAAGCAGCCGCTGG + Intergenic
1064428201 10:15248682-15248704 TGGCCACGCAGAGCAGCCTGAGG - Exonic
1064443108 10:15371066-15371088 CGGCGAGCCCGAGCCGCCGCCGG - Intergenic
1065483847 10:26217852-26217874 CGGAGACGCCGAGAAGCCGGCGG + Exonic
1069457215 10:68562187-68562209 TGGGGACGCCGAGCACACTCAGG - Intronic
1069544503 10:69318851-69318873 AGGAGCCGCCGAGCAGCCGCCGG + Intronic
1072810272 10:98456179-98456201 TGGCGAGGCCCAGCATCTGCAGG - Intergenic
1075144653 10:119872772-119872794 TGGGGCCGCCGAGGAGCTGCTGG + Intronic
1075584989 10:123651085-123651107 TGGCCACGCCAAGCAACCTCTGG - Intergenic
1077065811 11:640477-640499 TGACGGCGCTGACCAGCCGCGGG - Exonic
1077324120 11:1956381-1956403 TGGGGACGCCGCCCCGCCGCGGG - Exonic
1089845121 11:121452333-121452355 TGGCGACACGGAGCAGCAGGAGG + Exonic
1090808482 11:130217605-130217627 TGGCCACCCCCAGCAGCCCCTGG + Intergenic
1202807106 11_KI270721v1_random:11576-11598 TGGGGACGCCGCCCCGCCGCGGG - Intergenic
1091704012 12:2681561-2681583 TGGAGACGCAGAGCAGCAGCAGG - Intronic
1091710684 12:2738037-2738059 TGGAGACACAGAGCAGCAGCAGG - Intergenic
1091713535 12:2760101-2760123 TGGAGACGCAGAGCAGCAGCAGG - Intergenic
1097164782 12:57078248-57078270 TGGGCAGGCAGAGCAGCCGCGGG - Intronic
1098819086 12:75207485-75207507 CCGCGACGCCGAGGAGGCGCTGG - Exonic
1100679791 12:96907099-96907121 GGGCGGCGCTGGGCAGCCGCGGG - Intergenic
1116025049 14:39505112-39505134 TGGAGAGGCAGAGCTGCCGCTGG + Intergenic
1119998721 14:79279653-79279675 TAGCGCCACGGAGCAGCCGCCGG - Intronic
1121648195 14:95535317-95535339 CGCGGACGCCGTGCAGCCGCAGG - Exonic
1123014699 14:105368126-105368148 TGACGACGCCGTGCAGGGGCAGG + Exonic
1133146134 16:3788056-3788078 TGGAGATGCCGGGCAGCAGCTGG + Intronic
1133303319 16:4795961-4795983 GGGCGACGACCAGCAGCAGCAGG - Exonic
1139574113 16:67830630-67830652 TGGCAACGCTGAGTAGCAGCCGG - Intronic
1141579852 16:84989901-84989923 AGGAGACGCCCAGCAGCTGCAGG - Intronic
1141694506 16:85613289-85613311 TGCCGCCGCCGAGCAGCCCCGGG + Exonic
1141919349 16:87125734-87125756 TGGAGAAGCCGTGCAGCCTCCGG + Intronic
1142304164 16:89276209-89276231 TGGCGATGCCGGGCACCTGCAGG + Intronic
1144203092 17:12958838-12958860 TGGCGACGCTGAGGGGCCGGCGG - Exonic
1146912524 17:36657898-36657920 GGCCGCCGCCGAGCAGCCGCGGG - Intergenic
1148406990 17:47424136-47424158 CGGCGGCGCCGAGCAGCCCGTGG - Intronic
1150283326 17:63941886-63941908 TGGCCCCGCGGATCAGCCGCAGG + Exonic
1150747377 17:67826171-67826193 CGGCGACGCCGAGGAGACCCAGG + Exonic
1151591499 17:75047394-75047416 TGCCGCCGTCGCGCAGCCGCTGG + Exonic
1152703887 17:81833147-81833169 TGGTGTCGCCGCGCGGCCGCGGG - Intronic
1153688498 18:7568299-7568321 CGCCGACCCCGAGCAGCGGCCGG + Intronic
1155007441 18:21741334-21741356 CGCCGCCTCCGAGCAGCCGCGGG + Exonic
1158725708 18:59969690-59969712 CGGCGGCGCCGAGCAGCCCGTGG - Intergenic
1160767090 19:813445-813467 TGGCGTCGTCGGGCAGCCCCAGG + Exonic
1161312062 19:3600259-3600281 TGGCGGCCCCCAGCAGCAGCGGG + Exonic
1161477203 19:4493485-4493507 TGGGCACGCCGGGCAGCTGCTGG - Intronic
1162065657 19:8123820-8123842 TGGCGAAGCCCAGCCCCCGCGGG + Exonic
1168339529 19:55615196-55615218 CCGCGCCGCCGAGCAGCAGCGGG - Exonic
931633862 2:64324869-64324891 TGGGGACTTCGTGCAGCCGCAGG - Intergenic
947745319 2:232504166-232504188 TGGGGAGGCAGAGCTGCCGCGGG + Intergenic
948206966 2:236167624-236167646 GGGCGACGCGGAGAAGCCGCCGG + Exonic
948209117 2:236179287-236179309 AGCCGACGCCGGGCGGCCGCGGG - Intergenic
1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG + Exonic
1175256731 20:57652388-57652410 TCGGGACCCCGAGCAGCAGCTGG - Exonic
1176377076 21:6092053-6092075 GGGCGGGGCCGAGCGGCCGCGGG + Intergenic
1179746399 21:43446191-43446213 GGGCGGGGCCGAGCGGCCGCGGG - Intergenic
1180701936 22:17785889-17785911 TGGTGAAGCTGAGCAGCCACAGG + Intergenic
1182424337 22:30264207-30264229 TGGCGAGGCCGAACATCCTCGGG - Exonic
1184034099 22:41910474-41910496 TGCCGCCGCCCTGCAGCCGCGGG + Exonic
1185055300 22:48575975-48575997 AGGCGACGCCGAGCAGCGGGCGG + Intronic
1185343036 22:50300015-50300037 GGGCGGCGCCGAGGAGGCGCGGG - Intronic
952334288 3:32391757-32391779 TGGAGACGCGGAGCCGCCTCTGG - Exonic
963116936 3:141738320-141738342 TGGCGGCGCCGCGGAGCCGACGG - Exonic
968307360 3:197658619-197658641 AGGCGATCCCCAGCAGCCGCCGG + Intergenic
969301810 4:6301454-6301476 TGGAGGCGCGGAGCAGCCCCAGG - Exonic
975984583 4:80190440-80190462 GGGCGACGCCGGGCAGACGATGG + Intronic
981550528 4:145937529-145937551 GGGCGAGGCCGGGCAGCGGCGGG - Intronic
983649614 4:170025886-170025908 AGGGGACGCCGAACAGCCGTGGG - Intronic
988578023 5:32444904-32444926 TGGTGACGCCGCGCGGCCGCGGG + Intergenic
1002522679 5:179800310-179800332 TGGCTCCGCAGAGAAGCCGCTGG + Intronic
1006294567 6:33164398-33164420 CTGAGACGCTGAGCAGCCGCAGG + Exonic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1017309566 6:152959643-152959665 TGGCGTCGCCGAGCAACTGTGGG - Intergenic
1019191515 6:170253741-170253763 TGCCGACGCCGAGTCGCCTCAGG + Intergenic
1019562758 7:1666424-1666446 TGGGGACGCCCGGGAGCCGCGGG - Intergenic
1019903314 7:4041614-4041636 TGCCGACCCCCAGCAGCCACTGG + Intronic
1021992711 7:26152870-26152892 CGGCGGCGCCGAGCAGCCCGTGG - Exonic
1022427641 7:30284481-30284503 TGGCGAGGCGGAGCAGGGGCAGG + Exonic
1026797969 7:73377977-73377999 TGGCGACCCCGAGGAGGCCCGGG - Intergenic
1034413339 7:150952625-150952647 TGGCTACGCCTGCCAGCCGCTGG - Exonic
1034947143 7:155269826-155269848 GGGAGAGGCCGAGCAGCAGCAGG + Intergenic
1040038709 8:42896291-42896313 CGGCGACTCCGGACAGCCGCGGG + Exonic
1041281047 8:56211449-56211471 TGGCCACTCGGAGCCGCCGCTGG + Intergenic
1047454814 8:124998901-124998923 TGGCGACGGCGAGCAGCGGCCGG - Exonic
1049850183 8:144826700-144826722 CGGCGAAGCCCAGCAGCCGGAGG - Intergenic
1053269313 9:36739566-36739588 TGGCGGCTCCGAGCTGCCGCAGG - Intergenic
1061282579 9:129605969-129605991 TGGCGATGCTGAGCTGCGGCTGG - Intergenic
1061559734 9:131394506-131394528 TGGCGGCGCCGCGCGGCCTCAGG + Intronic
1189988722 X:46575326-46575348 GGGCGACGCGGAGCAGCCCAGGG + Exonic
1195716823 X:107826233-107826255 CGCCGACGCCGCGCAGCAGCCGG - Exonic
1197804302 X:130384637-130384659 TGCCCACGCCGAGCAGCCACAGG + Exonic