ID: 1173789638

View in Genome Browser
Species Human (GRCh38)
Location 20:45819624-45819646
Sequence CCTGACCCTCCTATTCTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173789638_1173789645 12 Left 1173789638 20:45819624-45819646 CCCAATAGAATAGGAGGGTCAGG No data
Right 1173789645 20:45819659-45819681 GAGAAGGAAATTGAGCCCTGAGG No data
1173789638_1173789646 13 Left 1173789638 20:45819624-45819646 CCCAATAGAATAGGAGGGTCAGG No data
Right 1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG No data
1173789638_1173789649 30 Left 1173789638 20:45819624-45819646 CCCAATAGAATAGGAGGGTCAGG No data
Right 1173789649 20:45819677-45819699 TGAGGGAGATGCACATTCCTTGG No data
1173789638_1173789644 -4 Left 1173789638 20:45819624-45819646 CCCAATAGAATAGGAGGGTCAGG No data
Right 1173789644 20:45819643-45819665 CAGGGAAAGGTTTTTGGAGAAGG No data
1173789638_1173789643 -10 Left 1173789638 20:45819624-45819646 CCCAATAGAATAGGAGGGTCAGG No data
Right 1173789643 20:45819637-45819659 GAGGGTCAGGGAAAGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173789638 Original CRISPR CCTGACCCTCCTATTCTATT GGG (reversed) Intergenic
No off target data available for this crispr