ID: 1173789646

View in Genome Browser
Species Human (GRCh38)
Location 20:45819660-45819682
Sequence AGAAGGAAATTGAGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173789640_1173789646 12 Left 1173789640 20:45819625-45819647 CCAATAGAATAGGAGGGTCAGGG No data
Right 1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG No data
1173789638_1173789646 13 Left 1173789638 20:45819624-45819646 CCCAATAGAATAGGAGGGTCAGG No data
Right 1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173789646 Original CRISPR AGAAGGAAATTGAGCCCTGA GGG Intergenic
No off target data available for this crispr