ID: 1173790043

View in Genome Browser
Species Human (GRCh38)
Location 20:45822665-45822687
Sequence GGAAGAACAGAAGAAGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173790033_1173790043 23 Left 1173790033 20:45822619-45822641 CCACCCTCCCCTACAACCACCAG No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790036_1173790043 16 Left 1173790036 20:45822626-45822648 CCCCTACAACCACCAGTACAATT No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790032_1173790043 26 Left 1173790032 20:45822616-45822638 CCTCCACCCTCCCCTACAACCAC No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790035_1173790043 19 Left 1173790035 20:45822623-45822645 CCTCCCCTACAACCACCAGTACA No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790040_1173790043 7 Left 1173790040 20:45822635-45822657 CCACCAGTACAATTTGAGGAGTA No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790037_1173790043 15 Left 1173790037 20:45822627-45822649 CCCTACAACCACCAGTACAATTT No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790034_1173790043 20 Left 1173790034 20:45822622-45822644 CCCTCCCCTACAACCACCAGTAC No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790041_1173790043 4 Left 1173790041 20:45822638-45822660 CCAGTACAATTTGAGGAGTAAGC No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data
1173790038_1173790043 14 Left 1173790038 20:45822628-45822650 CCTACAACCACCAGTACAATTTG No data
Right 1173790043 20:45822665-45822687 GGAAGAACAGAAGAAGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173790043 Original CRISPR GGAAGAACAGAAGAAGTAAA AGG Intergenic
No off target data available for this crispr