ID: 1173790044

View in Genome Browser
Species Human (GRCh38)
Location 20:45822689-45822711
Sequence CGAGCAGAAACAATGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173790041_1173790044 28 Left 1173790041 20:45822638-45822660 CCAGTACAATTTGAGGAGTAAGC No data
Right 1173790044 20:45822689-45822711 CGAGCAGAAACAATGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173790044 Original CRISPR CGAGCAGAAACAATGCTGCC TGG Intergenic
No off target data available for this crispr