ID: 1173790331

View in Genome Browser
Species Human (GRCh38)
Location 20:45824057-45824079
Sequence GGCCTCCGGGGAGCACGTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173790331_1173790338 4 Left 1173790331 20:45824057-45824079 CCGTCACGTGCTCCCCGGAGGCC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1173790338 20:45824084-45824106 AAATCTCAGCCAGCTCCTCCGGG 0: 1
1: 0
2: 2
3: 25
4: 228
1173790331_1173790337 3 Left 1173790331 20:45824057-45824079 CCGTCACGTGCTCCCCGGAGGCC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1173790337 20:45824083-45824105 AAAATCTCAGCCAGCTCCTCCGG 0: 1
1: 0
2: 0
3: 23
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173790331 Original CRISPR GGCCTCCGGGGAGCACGTGA CGG (reversed) Exonic
900095086 1:936974-936996 GTCCTGTGGGGTGCACGTGATGG + Intronic
901944562 1:12691224-12691246 GGCTTCTGGGGAACAGGTGAGGG + Intergenic
902024233 1:13371131-13371153 GGCCTCTGGGGAGCAGGACAGGG + Exonic
902026873 1:13390415-13390437 GGCCTCTGGGGAGCAGGAGAGGG - Exonic
903502737 1:23810561-23810583 GGCCTCTAGGGAGCAAGTGCAGG + Intronic
903662625 1:24987590-24987612 GGCGTCTGGAGAGCACCTGATGG - Intergenic
905384874 1:37595685-37595707 GGGCTCCGAGGAGCACTGGAGGG - Intronic
905505515 1:38476299-38476321 AGCCTCCCGGGAGCAGGAGAAGG - Intergenic
906694984 1:47817718-47817740 GTCCTGCGAGGAGCCCGTGAAGG - Intronic
909099480 1:71332752-71332774 GCCCTCCAGTGAGCACGTAATGG + Intergenic
910401575 1:86842829-86842851 TGCTTCCAGGGAGCACTTGATGG + Intergenic
914456440 1:147841322-147841344 GGCCTCTGGGGAGCAGGACAGGG - Intergenic
916498157 1:165364062-165364084 GGCATCCGGGGAGAAAGTCAAGG + Intergenic
922803887 1:228375983-228376005 GGCCACACAGGAGCACGTGAGGG - Intronic
922980609 1:229823319-229823341 GACCTCCTGGGAGGAGGTGATGG + Intergenic
923038362 1:230301228-230301250 GGCCTCCAGAGAGCAGGCGAGGG - Intergenic
1062810226 10:457933-457955 GGCCCCAGAGCAGCACGTGATGG + Intronic
1067257886 10:44661848-44661870 GGGGACCGGGGAGCACATGAGGG - Intergenic
1069903540 10:71719540-71719562 GGACTCCTGGGAGAATGTGAGGG - Intronic
1069911364 10:71761799-71761821 GGCCTCCATGGTGCAGGTGAAGG + Exonic
1070829433 10:79409539-79409561 GGGCTCTGGGGAGCAGGTGAAGG + Intronic
1073075652 10:100824685-100824707 GGCCAGTGGGGGGCACGTGAGGG - Exonic
1074393575 10:113078486-113078508 GACCTCCTGGGATCAAGTGATGG + Intronic
1075799535 10:125144640-125144662 GGCCTCGGGGGCGCTCCTGAAGG + Intronic
1076811724 10:132889717-132889739 GGCCTCCGGGGAGGAGGAGACGG - Intronic
1077367466 11:2166968-2166990 CGCCTGCGGGGAGCACCTGGAGG - Exonic
1077378257 11:2215687-2215709 GGCCGCTGGGGAGTAGGTGAAGG + Intergenic
1080647467 11:34197420-34197442 GGCGTCGGGGGACCAAGTGATGG + Exonic
1081484245 11:43515712-43515734 GGGCCCCGGGCAGGACGTGAAGG - Intergenic
1082765457 11:57164033-57164055 GTCCTCAGTGGAGCACATGAGGG - Intergenic
1083986503 11:66219256-66219278 GGCCTGCGGGGAGAACGAGAAGG + Intronic
1084062851 11:66687282-66687304 GGCCTCAGGGGAGGACCAGAGGG - Intronic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1089003277 11:115069556-115069578 GGCCTCAGGGAACCGCGTGAGGG - Intergenic
1089308825 11:117544486-117544508 AGCCTGCGGGGAGCAAGTCAAGG + Intronic
1091793879 12:3286390-3286412 TGCCCCCGGGCAGCACGGGAGGG + Exonic
1091937478 12:4445258-4445280 GGCCGTCGGGGAGCACCTGGAGG + Exonic
1096518168 12:52169859-52169881 GGCCTGTGGGGAGCACTGGAGGG - Exonic
1097267542 12:57755026-57755048 GGGCGCCGGGGAGCGGGTGAAGG - Intronic
1101459658 12:104877919-104877941 TGCCTCCGGGGTTCAAGTGATGG - Intronic
1103620800 12:122186051-122186073 GGCTTCCGGGGAGCAGGGGGTGG + Intronic
1103940758 12:124500099-124500121 GGCCTCCGAGGAGAACAAGACGG + Intronic
1104771278 12:131366333-131366355 GGTCATCAGGGAGCACGTGAGGG - Intergenic
1105303739 13:19155449-19155471 GCCCACTGGGGAGCACGTGCTGG - Intergenic
1105518114 13:21108844-21108866 GGGCACCGGGAAGCACTTGAGGG - Intergenic
1106516912 13:30464548-30464570 GGCCTGCCGGGCGCACGTGGCGG - Intronic
1110727437 13:78841482-78841504 GGCCTCTGTGGAGCACTTTATGG + Intergenic
1114529435 14:23386602-23386624 GGCCTCCCTGGAGCACGAGGAGG - Exonic
1114534838 14:23416291-23416313 GGCCTCCCTGGAGCACGAGGAGG - Exonic
1114704640 14:24713034-24713056 GGCCTCAGGGGAGCACACCAGGG - Intergenic
1118258507 14:64225659-64225681 GGGCTCCAGGGAGCCCGTGCTGG - Exonic
1118905231 14:70018756-70018778 CCCCTCAGGGGACCACGTGAAGG - Intronic
1119129609 14:72159339-72159361 GGCCTCCGGGCAGAGTGTGAGGG + Intronic
1119320379 14:73726798-73726820 GGCCTGGGGGCAGCAAGTGAGGG - Intronic
1122505277 14:102227845-102227867 GACCACTGGAGAGCACGTGAAGG + Intronic
1122602994 14:102930478-102930500 GGCCTCCGAGGAGCTGGTGAGGG + Exonic
1124873982 15:33573380-33573402 GGCCTTCTGGGAGCACATTAAGG + Intronic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1129710532 15:77818522-77818544 GGCCTCTTGGGAGCTCCTGAGGG + Intronic
1131062514 15:89412668-89412690 GGGCTCCAGGGCACACGTGAAGG - Intergenic
1132292639 15:100714088-100714110 GGCCCCCTGGGAGCACGTGCAGG + Intergenic
1132516675 16:369292-369314 AGCCTCCGGGGGGGAGGTGAGGG - Intronic
1132678300 16:1129722-1129744 GGCCCCCGGGGTTCACCTGAGGG - Intergenic
1132808686 16:1787527-1787549 GGCCTCCCGAGAGCCTGTGATGG + Intronic
1136300268 16:29329600-29329622 GGCCTCCCGGGAGCTCATGCTGG + Intergenic
1137695218 16:50457062-50457084 GGCCTCCAAAGAGCAGGTGATGG + Intergenic
1142061998 16:88036364-88036386 GGCCTCCTGGGAGCTCATGCTGG + Intronic
1142175604 16:88643620-88643642 GGCCTCCGGGGAGGGAGGGAGGG - Intronic
1142347983 16:89566042-89566064 CGCCCCCGGGGAGCACGGGCTGG + Exonic
1142421450 16:89972844-89972866 GGCCGCGGGGGAGCGCGGGAGGG + Intergenic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1143015095 17:3887463-3887485 GGCCTCCCTGGAGGAGGTGAAGG + Intronic
1146268495 17:31468899-31468921 GGCCCCTCTGGAGCACGTGAGGG + Intronic
1146584266 17:34068817-34068839 GCCCTCAGGGGAGCAGGTGGTGG + Intronic
1148544440 17:48506596-48506618 TGCATCCGTGGAGCACATGAGGG + Intergenic
1151255214 17:72871503-72871525 GGCCTCTGGGGAGGAGGAGAGGG + Intronic
1151673805 17:75588111-75588133 GGCCTCAGGGGAGCAGGAGTCGG + Intergenic
1151773072 17:76177567-76177589 GGCCTTCAGGGAGGACGTGAAGG + Intronic
1152612639 17:81323181-81323203 GGCCTCGGGGGAGCCCTGGACGG + Intronic
1152716893 17:81904532-81904554 GGCATCCGGGGACCAGGTGGGGG + Exonic
1152873512 17:82772350-82772372 GGCCCTCGGGGAGCTGGTGAGGG + Intronic
1152896284 17:82913300-82913322 AGCACACGGGGAGCACGTGAAGG - Intronic
1152925342 17:83085096-83085118 GGCCCCCGAGGAGTCCGTGAAGG - Exonic
1153285586 18:3451941-3451963 GGCCTCCCGGGAATAAGTGAGGG + Exonic
1154318390 18:13324607-13324629 GGCATCCGGGCAGCAGGGGAGGG + Intronic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1155810200 18:30223439-30223461 GGCCTCTGGGCAGCACATGCAGG - Intergenic
1156297701 18:35807973-35807995 GACCTCCAGGGAGCATGGGAGGG - Intergenic
1156405398 18:36778231-36778253 GGCCTCTGGGGAGTAGATGAGGG + Intronic
1157874086 18:51255452-51255474 GGCCTCCTTGGACCACGTGAGGG + Intergenic
1159402011 18:67950849-67950871 TGCAGCCAGGGAGCACGTGATGG + Intergenic
1160772856 19:840858-840880 GGACTCCGGGGAGGAGGTGGGGG - Intergenic
1160858013 19:1226104-1226126 TGCCCCAGGGGAGCACGGGAGGG + Intronic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1162026802 19:7899026-7899048 GGTCTCCGGGGAGAACCAGAAGG + Exonic
1162584844 19:11552366-11552388 GGCCGATGGGGAGCACCTGAGGG - Intronic
1163426774 19:17244715-17244737 AGCCTCCAGGGACCACCTGATGG + Intronic
1164710404 19:30353272-30353294 GGGCTCCGAGGTGCACTTGAAGG + Intronic
1165022195 19:32934326-32934348 GGCCTGTGGGCAGCACCTGAAGG + Intronic
1166040357 19:40198579-40198601 GGCCTCTGGGGAGTAAGGGAGGG + Intronic
1166294527 19:41882695-41882717 GGCTTTCGGGGAGAAAGTGATGG + Intergenic
925156395 2:1651663-1651685 GGCCTCCCTGGAGCATCTGAGGG - Intronic
925169443 2:1742050-1742072 TGTCTCCTGGGAGAACGTGAGGG - Intronic
926738739 2:16093902-16093924 GACCTCCGGGGAGCATGGCAGGG + Intergenic
933248655 2:80003807-80003829 GGCTTCTGGGGATCACATGAGGG + Intronic
937427965 2:121815507-121815529 GGGCTCCGTGGAGAAGGTGAAGG + Intergenic
938236417 2:129709990-129710012 GGCCTCCAGGGGCCGCGTGAGGG - Intergenic
941448909 2:165635183-165635205 GGCCCCTGGGGTGCCCGTGAGGG + Intronic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
1169221106 20:3823581-3823603 GGCCTCTGTGAAGCAGGTGAGGG + Intronic
1171207082 20:23289538-23289560 AGCCCCCTTGGAGCACGTGAGGG - Intergenic
1173729121 20:45316608-45316630 GGGCCCCGGGGAGCAGGGGAAGG + Intronic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1173970943 20:47151694-47151716 GGCGTCCTGGGAGCATATGATGG - Intronic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1175161310 20:57009886-57009908 GGGCAGCGGGGAGCAAGTGAAGG - Intergenic
1175215380 20:57389600-57389622 GGCCTCTAGGGGGCAAGTGAAGG + Intergenic
1179474209 21:41633003-41633025 GGTCTGAGGGGAGCAAGTGAAGG - Intergenic
1179953263 21:44723681-44723703 GGCCTCCGAGGAGCAAGGAAAGG + Intergenic
1180075722 21:45460486-45460508 GGCCACGGGAGTGCACGTGAAGG + Intronic
1181000650 22:19986515-19986537 TGCCTCCGAGGCGCACGTGATGG - Intronic
1182359828 22:29739936-29739958 GGCCTCAGGGTAGCCAGTGAAGG - Intronic
1183654896 22:39178949-39178971 GGCCTTCAGGGAGGAGGTGACGG + Intergenic
1184410264 22:44322252-44322274 GGGCTACGGTGAGCAGGTGAGGG + Intergenic
1184479145 22:44736997-44737019 GGGCGCCGGGGAGGACCTGAAGG - Exonic
1184582165 22:45425272-45425294 GGCCTCTGGTGAGCACATGTGGG + Intronic
952942561 3:38455054-38455076 GGCCTCCAGGAGGCACGTGGCGG + Intronic
953246550 3:41199240-41199262 GGCCTGAGGGCAGCCCGTGAGGG - Intronic
953414019 3:42705318-42705340 GGGCTCCTGGGAGCAGGGGAGGG + Intronic
953822589 3:46221481-46221503 GGGCTGCGGGGGGCATGTGAGGG - Intronic
953883426 3:46702888-46702910 GGCCTCAGGGCAGCCTGTGAGGG - Intronic
955774023 3:62414810-62414832 GACCTCCAGGGAGGACGGGAAGG + Intronic
959918774 3:111847980-111848002 GGGCTGAGGGGTGCACGTGAGGG + Intronic
961541941 3:127606155-127606177 GGCAGCCAGGGAGCACGTGCTGG + Exonic
962629338 3:137259961-137259983 GGCCTCCGGAGAGAGCCTGAGGG - Intergenic
968523287 4:1044132-1044154 CGCCTCCGGGGACCACGTGGTGG - Intergenic
968965695 4:3768095-3768117 GGCCTCCAGGGCGCAGGGGAGGG + Exonic
969444875 4:7239090-7239112 AGCCTCTGGGGAGCACAGGAAGG - Intronic
971148939 4:24010421-24010443 TGACTCCGGGGAGCGAGTGAGGG - Intergenic
984206541 4:176793047-176793069 GGCCGCCGGGGAGGAGGCGAGGG - Intergenic
985579909 5:691185-691207 GCCCTCCGAGGATCACGTGGTGG + Intronic
985594756 5:783244-783266 GCCCTCCGAGGATCACGTGGTGG + Intergenic
986317767 5:6601940-6601962 GGCCTTGGGGGAGCAGGTGCTGG - Intronic
995623781 5:114055568-114055590 GGCAGCCGGGGAGGGCGTGATGG + Intergenic
1001959044 5:175869095-175869117 GGCCTTCGGGAAGCATGTCAAGG + Intronic
1002533400 5:179862956-179862978 GGCTCCCGGAGAGCACCTGAGGG + Exonic
1002565743 5:180112312-180112334 GGCCTGTGGGTAGCATGTGACGG + Intronic
1006439327 6:34043403-34043425 GGCCTGCGGGGAGCAAGTGTGGG - Intronic
1007248878 6:40482382-40482404 GGCCCCTGGGGACCACGTGGAGG + Intronic
1010032811 6:71288565-71288587 GGCCGCCGGGGGCCGCGTGAAGG + Intergenic
1010735300 6:79437184-79437206 GGACTCCAGGGAGCCCGTGGAGG + Intergenic
1013793620 6:113860207-113860229 GGCCTCCGGGGAGCAGGCAGCGG + Exonic
1015054496 6:128883272-128883294 GGCCTCCGGAGAGCAGCAGAAGG - Exonic
1017534784 6:155335239-155335261 GACCTGGGGGGAGCACGGGAGGG - Intergenic
1018670557 6:166173418-166173440 GGCCTCTGGGGAGCTCCTGCTGG - Intergenic
1018867885 6:167759622-167759644 GGGCTCTGGGGAGGCCGTGAAGG + Intergenic
1018941250 6:168310013-168310035 GGCCTCCGTGGGCCACGTGGTGG - Intronic
1019379626 7:714053-714075 GGGCCGCGGGGAGCACGTGATGG - Intronic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1019996026 7:4725038-4725060 GGCCTCGGGGGAGCTCCTGCTGG - Intronic
1022360132 7:29649545-29649567 GTGCACTGGGGAGCACGTGAGGG + Intergenic
1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG + Intronic
1024365016 7:48510403-48510425 GGCCTGCAGGGAGCACCTTAAGG + Intronic
1027025887 7:74851414-74851436 GGCCACCGGGGAGCAGCCGATGG + Exonic
1027061872 7:75092696-75092718 GGCCACCGGGGAGCAGCCGATGG - Exonic
1029205880 7:98869365-98869387 GTCCCCCAGGGAGCACGGGATGG - Intronic
1029611841 7:101630732-101630754 TGCCTCCGGGGAGCACGCCCAGG + Intergenic
1032461432 7:132114305-132114327 GGCCTCCGGGGAGCATGAAGAGG + Intergenic
1037812320 8:22094466-22094488 GGCCTTCGTGGAGCACTGGAAGG + Exonic
1039822267 8:41144802-41144824 GGTCTCCGGGTAGCAGGTGGTGG + Intergenic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1043874396 8:85467994-85468016 GGGCTCCGGGGAACAGGAGAGGG - Intronic
1044428554 8:92082514-92082536 GGCCTCAAGGGAGGACTTGATGG - Intronic
1046135340 8:110018668-110018690 GGCCTCCAGGTGGCACATGAAGG + Intergenic
1049382837 8:142325921-142325943 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049382895 8:142326165-142326187 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049661581 8:143821959-143821981 GCCCTCCTGGGGCCACGTGAAGG - Intronic
1058161051 9:101571109-101571131 GGCCTGGGGTGAGAACGTGAGGG + Exonic
1060181056 9:121534079-121534101 GGCATTCTGGGAGCAGGTGAAGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061816351 9:133199725-133199747 GGCCTCCCGGGAGCCAGGGACGG + Intergenic
1061908384 9:133710410-133710432 GGGCTCCGGGCTGCGCGTGAGGG - Intronic
1062144707 9:134982636-134982658 GGCCTCTGGGCAGCAAGGGAAGG - Intergenic
1186189689 X:7056372-7056394 GGCCTGCCGGGAGCATGTGCAGG - Intronic
1202109153 Y:21403759-21403781 GGTCTCCGAGGGGCACGTGGTGG - Intergenic
1202120121 Y:21512360-21512382 GGTCTCCGAGGGGCACGTGGTGG + Intronic
1202122572 Y:21535901-21535923 GGTCTCCGAGGGGCACGTGGTGG + Intronic
1202156433 Y:21893482-21893504 GGTCTCCGAGGGGCACGTGGTGG - Intronic
1202158881 Y:21917023-21917045 GGTCTCCGAGGGGCACGTGGTGG - Intronic
1202185333 Y:22181938-22181960 GGCCTCCGAGGGGCACGTGGTGG - Intronic
1202197532 Y:22309847-22309869 GGTCTCCGAGGGGCACGTGGTGG + Intronic
1202206027 Y:22404457-22404479 GGCCTCCGAGGGGCACGTGGTGG + Intronic