ID: 1173791733

View in Genome Browser
Species Human (GRCh38)
Location 20:45832493-45832515
Sequence GACAGTAAAGTGCCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173791725_1173791733 20 Left 1173791725 20:45832450-45832472 CCAGTTACAGCCTCTTCCCCAGG 0: 1
1: 0
2: 1
3: 32
4: 259
Right 1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1173791731_1173791733 3 Left 1173791731 20:45832467-45832489 CCCAGGACGCTGTGAGGGAGAGA 0: 1
1: 0
2: 3
3: 19
4: 315
Right 1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1173791730_1173791733 4 Left 1173791730 20:45832466-45832488 CCCCAGGACGCTGTGAGGGAGAG 0: 1
1: 0
2: 1
3: 29
4: 294
Right 1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1173791732_1173791733 2 Left 1173791732 20:45832468-45832490 CCAGGACGCTGTGAGGGAGAGAT 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1173791727_1173791733 10 Left 1173791727 20:45832460-45832482 CCTCTTCCCCAGGACGCTGTGAG 0: 1
1: 0
2: 4
3: 30
4: 275
Right 1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1173791724_1173791733 30 Left 1173791724 20:45832440-45832462 CCATTAATGTCCAGTTACAGCCT 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173791733 Original CRISPR GACAGTAAAGTGCCTAGAGC AGG Intronic
900525369 1:3125871-3125893 GACAGCAATGGGCCTGGAGCTGG - Intronic
902401474 1:16159936-16159958 TACAGATAAGTGCCTAGAACTGG - Intergenic
903848004 1:26289909-26289931 TGCAGTAAAGTCCCCAGAGCGGG - Intronic
904853769 1:33479498-33479520 GACAGCAGAGAGCCCAGAGCTGG - Exonic
906945125 1:50288746-50288768 GCCACTAAAGAGCCTGGAGCAGG - Intergenic
913518615 1:119625017-119625039 GAGATTACAGAGCCTAGAGCTGG + Intronic
915627768 1:157126162-157126184 GACAGTGAAGAGCCTAGAGAAGG - Intronic
918952845 1:191161509-191161531 CACAGTAGAGTGACTATAGCAGG + Intergenic
923271891 1:232363031-232363053 GACAGTAAATTACATGGAGCAGG - Intergenic
1062861246 10:812084-812106 GACAGAAATGTGCACAGAGCAGG + Exonic
1063158797 10:3404159-3404181 GACAGAAAAGTGGCAATAGCGGG + Intergenic
1065949383 10:30638099-30638121 GTCAGTAACATGCCTACAGCAGG + Intergenic
1066322764 10:34321523-34321545 GATAGTTCAGTGCATAGAGCAGG - Intronic
1066472158 10:35709664-35709686 GTAAGCATAGTGCCTAGAGCTGG + Intergenic
1067675435 10:48371468-48371490 CACAGTAAAGTGCTTCGAGGGGG - Intronic
1071486533 10:86106126-86106148 GACAGGAAATTTCCTAGAGCAGG - Intronic
1072148278 10:92663555-92663577 GACAGTAAAACTCCTAGACCTGG - Intergenic
1078341317 11:10499633-10499655 GTGAGTAAAGTGCTTTGAGCAGG + Intronic
1085958691 11:81433308-81433330 GACAGTAACATGCATAGAGCTGG + Intergenic
1086003806 11:82012202-82012224 GGAAGTAAAGTGCCTTGACCTGG - Intergenic
1089039715 11:115435268-115435290 GACAGTAAAGGGTCTGGAACTGG + Intronic
1090339011 11:125998829-125998851 GACAATCAAGTTTCTAGAGCTGG + Intronic
1090627962 11:128622319-128622341 GACAGCAAAGAGCTTGGAGCAGG + Intergenic
1093678410 12:21971235-21971257 GACACTGAAGTGGTTAGAGCAGG - Intergenic
1096739957 12:53685837-53685859 GACAGTAAAATGACTACAGGTGG + Intergenic
1100682412 12:96941560-96941582 GAGAGAAAAGTGACTAGTGCTGG + Intronic
1103977645 12:124713913-124713935 TTAAATAAAGTGCCTAGAGCAGG + Intergenic
1104082064 12:125437786-125437808 GACAGCAGAGTGCCAGGAGCAGG + Intronic
1107003056 13:35573801-35573823 GAAATTAAAGTGCATAAAGCAGG - Intronic
1111560684 13:89941193-89941215 GACAGTAAATTGCTTAGAAATGG + Intergenic
1111658962 13:91185673-91185695 GAAACTAAGGTGCCTAAAGCTGG - Intergenic
1112562356 13:100525872-100525894 GAGAGAACAGTGCCCAGAGCGGG + Intronic
1125903410 15:43369781-43369803 GACAGCAAAGTTCCCAGAGTTGG + Exonic
1127838677 15:62811095-62811117 GGCAGTGAAATGCCCAGAGCTGG - Intronic
1128087406 15:64895527-64895549 GGCAGTAAAGTGTCTTGAGAAGG - Intronic
1130677317 15:85964723-85964745 GACAGCCATGTGCCTAGAGGAGG - Intergenic
1130842293 15:87712295-87712317 GACAGTAAAGTGCTTAAAAAAGG + Intergenic
1131035993 15:89222324-89222346 GGCAGTAAAGTGCTTAGTTCAGG + Intergenic
1134517799 16:14900999-14901021 GACAATGAAATGCCTAGAGAAGG + Intronic
1134705468 16:16299650-16299672 GACAATGAAATGCCTAGAGAAGG + Intergenic
1134962073 16:18412464-18412486 GACAATGAAATGCCTAGAGAAGG - Intergenic
1134966371 16:18495063-18495085 GACAATGAAATGCCTAGAGAAGG - Intronic
1136005625 16:27326941-27326963 GACAGTAACCTACCTAGAACTGG - Intronic
1136557095 16:31013706-31013728 GACAGGAGAGGGCCTAGAGACGG - Intergenic
1136924943 16:34363138-34363160 CCCAGTAAAGTGGCTAGAGTGGG - Intergenic
1136979630 16:35048668-35048690 CCCAGTAAAGTGGCTAGAGTGGG + Intergenic
1141557853 16:84847680-84847702 GAAAGTGAAGTGTCTAAAGCAGG + Intronic
1144027966 17:11295393-11295415 GACTGTAAGTTGCCAAGAGCAGG - Intronic
1144765859 17:17732072-17732094 AACAGCAAAGTGCCCAGGGCTGG - Intronic
1145240485 17:21238205-21238227 GGCAGTAAAGTTCCTGGATCTGG + Intergenic
1150261313 17:63794149-63794171 GACAGCAGAGAGCCTAAAGCAGG - Intronic
1154490192 18:14916161-14916183 GATTGTAAAGTGCCTAAAGGGGG + Intergenic
1159960449 18:74551502-74551524 GACAGCAAATTGACTATAGCAGG + Intronic
1160780694 19:876796-876818 GTCAGTAAAGTGCCAGCAGCAGG - Intronic
1164965665 19:32480708-32480730 GTCACTAAAGTGCCAAGAGAGGG - Intronic
927930316 2:27039659-27039681 GACACTACAGGGCCCAGAGCAGG - Intronic
928088960 2:28362444-28362466 TACTGTAAAGTGCTTAGAACAGG + Intergenic
928872728 2:35999777-35999799 GCCAGTACAGTGCCTGGGGCTGG - Intergenic
934905796 2:98201371-98201393 TACAACAAAGTTCCTAGAGCAGG - Intronic
937701247 2:124865514-124865536 GCCAGTGTAGTGCCTAGTGCTGG + Intronic
938210205 2:129460622-129460644 AACAGTCAAGTGCCTACAACTGG - Intergenic
943043173 2:182827030-182827052 GAGAACAGAGTGCCTAGAGCAGG - Intergenic
944926398 2:204469299-204469321 GTCAGTCAAGTTCCAAGAGCTGG + Intergenic
945074086 2:206020281-206020303 GACAATAAGGTACCTTGAGCTGG + Intronic
945273257 2:207962770-207962792 GACAGTGCAGTGCCCAGAGCAGG + Intronic
946000344 2:216476979-216477001 GACAGTGAAGTGCTTTGAGGAGG + Intronic
946125185 2:217556531-217556553 GAAAATAAAGTGCCCACAGCAGG + Intronic
1170015009 20:11770530-11770552 GACAGGACACTGCCTGGAGCAGG + Intergenic
1171427839 20:25059399-25059421 GACAGGAGTGTACCTAGAGCTGG + Intergenic
1171749243 20:29031832-29031854 AGCACTAAAGTGCCTTGAGCAGG + Intergenic
1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG + Intronic
1173794972 20:45853505-45853527 GCCAGTAAAGTATCTAGTGCAGG - Intronic
1176315937 21:5243856-5243878 AGCACTAAAGTGCCTTGAGCAGG - Intergenic
1177366442 21:20144658-20144680 GAAAGTAAAGTGCCCATAGGTGG - Intergenic
1179557344 21:42188143-42188165 GAGAGTAAAGTGCTGAGCGCGGG + Intergenic
1180393736 22:12309797-12309819 AGCACTAAAGTGCCTTGAGCAGG - Intergenic
1180406010 22:12554951-12554973 AGCACTAAAGTGCCTTGAGCAGG + Intergenic
949096301 3:89881-89903 GACAGTGAATTGTCTGGAGCAGG + Intergenic
951665582 3:25119794-25119816 GACTATAAGATGCCTAGAGCTGG + Intergenic
953904128 3:46859813-46859835 GACTGTAAAGTGCCTCGCGATGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
966564038 3:181356167-181356189 GACAGTAAACTGATTAAAGCTGG - Intergenic
967788092 3:193519106-193519128 GAAACTAAAATGCCTAAAGCAGG - Intronic
968038714 3:195570514-195570536 ACCAGTCAAGTGCCTAGAGCGGG - Intronic
970254547 4:14154037-14154059 GACAGTGAGGGGCCTGGAGCAGG - Intergenic
971731792 4:30393453-30393475 TACAGAAAAGTGCCTTGAGGAGG - Intergenic
976831889 4:89324457-89324479 GACAGTGAGGTCCCTGGAGCTGG + Intergenic
980559078 4:134448375-134448397 GAGAGTAAAGTGGGGAGAGCAGG - Intergenic
981229946 4:142340802-142340824 GAAATTAAAGCCCCTAGAGCAGG + Intronic
984755636 4:183323537-183323559 GACAGAAAAGTCCCTAAAGGTGG + Intergenic
985431153 4:189881574-189881596 AGCACTAAAGTGCCTTGAGCAGG + Intergenic
987145823 5:14990545-14990567 GACAATAAGGTGCCTAGAATAGG - Intergenic
997329766 5:133051710-133051732 CTCAGTATAGTGCCTCGAGCTGG + Intergenic
998226162 5:140328112-140328134 GTGAGTAAAGTGCCTAGCTCAGG - Intergenic
999938058 5:156509498-156509520 AACAGCAATGTGCCTAGAACAGG - Intronic
1001499869 5:172222571-172222593 AACAGAAAAGTGACTAGAGTTGG + Intronic
1002134386 5:177098827-177098849 GACAGGAGAGTGCCAAGTGCTGG - Intergenic
1003661038 6:8062308-8062330 GACATTAAATACCCTAGAGCAGG + Intronic
1006937477 6:37728457-37728479 GCAAGGAAAGTGCCAAGAGCTGG - Intergenic
1007109683 6:39305766-39305788 GCCAGCAATGTGGCTAGAGCTGG - Intronic
1008048148 6:46872747-46872769 GAGAGTAAAGGGACTAGAGTAGG - Intronic
1009883539 6:69598918-69598940 GACAGAAAAGGGCCAGGAGCAGG + Intergenic
1009891716 6:69692376-69692398 GACATTAAAGTGACTAGAAATGG - Intronic
1016805358 6:148206886-148206908 GACAGCAAAATGCCTGGAGCTGG - Intergenic
1018600828 6:165538892-165538914 GACAGTAAATTTCCTCCAGCTGG - Intronic
1019070316 6:169340350-169340372 GAGAGGAAAGTGCCTGGGGCTGG + Intergenic
1022949502 7:35322480-35322502 GTCAGTAAAGTGTCTCCAGCTGG + Intergenic
1023247223 7:38217814-38217836 AACAGTTAAATGCCTAGGGCTGG + Intronic
1025098574 7:56116469-56116491 GGCGGTACAGTGCCTGGAGCAGG + Intergenic
1025834411 7:65081382-65081404 GGCTGTACAGTGCCTGGAGCTGG + Intergenic
1026038223 7:66845050-66845072 GACGGTACAGTGCCTGGAGCTGG + Intergenic
1027213187 7:76166542-76166564 GACGCTACAGTGCCTGGAGCTGG - Intergenic
1027631965 7:80617888-80617910 GATAGTAAAGTGCCAAAAGTTGG + Intronic
1028549997 7:92049795-92049817 GACATTAAAGTACCTAGAAAAGG - Intronic
1032538943 7:132687501-132687523 GACAGTGCAGTGGCTGGAGCAGG - Intronic
1033175905 7:139123528-139123550 CACAGTACAGAGCCCAGAGCAGG - Intergenic
1033448451 7:141441783-141441805 AACAGAAAAGTGCCCAGCGCAGG - Intronic
1033736791 7:144230174-144230196 GACAGAAAAGTACTTAAAGCTGG - Intergenic
1033746266 7:144320776-144320798 GACAGAAAAGTACTTAAAGCTGG + Intergenic
1034384957 7:150733290-150733312 GGCAGGACAGTGCCTAGAGCAGG - Intronic
1035483451 7:159204399-159204421 GACTGTCAAGTGTTTAGAGCTGG + Intergenic
1040291789 8:46129289-46129311 GACAATAAAGTGGCGTGAGCAGG - Intergenic
1045675391 8:104601725-104601747 TACAGTAAAATCCCTAGATCAGG - Intronic
1046736873 8:117786260-117786282 AACAGTAACGTGCTCAGAGCTGG + Intergenic
1047165383 8:122432621-122432643 GACAGCAAAGTGCCTCATGCTGG + Intergenic
1053720330 9:40939594-40939616 AGCACTAAAGTGCCTTGAGCAGG + Intergenic
1056778290 9:89530531-89530553 CACAGAAAAGTGCATAGAGCTGG - Intergenic
1058154279 9:101496021-101496043 AACAGGAAAATGCCTTGAGCAGG + Intronic
1190690528 X:52909646-52909668 GTGGGTGAAGTGCCTAGAGCCGG + Intergenic
1190695455 X:52946146-52946168 GTGGGTGAAGTGCCTAGAGCCGG - Intronic
1195681799 X:107552766-107552788 GACAGAAAAGAGCCTTGAGAGGG - Intronic
1200278085 X:154752700-154752722 TACAGGAAAGTTGCTAGAGCAGG - Intergenic