ID: 1173791799

View in Genome Browser
Species Human (GRCh38)
Location 20:45832893-45832915
Sequence CCTCTGAGGGAGGCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13059
Summary {0: 1, 1: 4, 2: 86, 3: 538, 4: 12430}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173791789_1173791799 5 Left 1173791789 20:45832865-45832887 CCTGGGCTCCAGGCCCCATACTC 0: 1
1: 0
2: 2
3: 43
4: 506
Right 1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG 0: 1
1: 4
2: 86
3: 538
4: 12430
1173791791_1173791799 -8 Left 1173791791 20:45832878-45832900 CCCCATACTCAGAAACCTCTGAG 0: 1
1: 0
2: 0
3: 16
4: 296
Right 1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG 0: 1
1: 4
2: 86
3: 538
4: 12430
1173791794_1173791799 -10 Left 1173791794 20:45832880-45832902 CCATACTCAGAAACCTCTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 191
Right 1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG 0: 1
1: 4
2: 86
3: 538
4: 12430
1173791790_1173791799 -3 Left 1173791790 20:45832873-45832895 CCAGGCCCCATACTCAGAAACCT 0: 1
1: 0
2: 1
3: 16
4: 209
Right 1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG 0: 1
1: 4
2: 86
3: 538
4: 12430
1173791792_1173791799 -9 Left 1173791792 20:45832879-45832901 CCCATACTCAGAAACCTCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 167
Right 1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG 0: 1
1: 4
2: 86
3: 538
4: 12430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173791799 Original CRISPR CCTCTGAGGGAGGCAGAGGC AGG Intronic
Too many off-targets to display for this crispr