ID: 1173793051

View in Genome Browser
Species Human (GRCh38)
Location 20:45840624-45840646
Sequence GTGTAGAGCTGCAGGGAGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 484}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173793051_1173793057 -2 Left 1173793051 20:45840624-45840646 CCACCCTCCCTGCAGCTCTACAC 0: 1
1: 0
2: 4
3: 44
4: 484
Right 1173793057 20:45840645-45840667 ACCCTCGCCGTGATCGGCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 38
1173793051_1173793056 -8 Left 1173793051 20:45840624-45840646 CCACCCTCCCTGCAGCTCTACAC 0: 1
1: 0
2: 4
3: 44
4: 484
Right 1173793056 20:45840639-45840661 CTCTACACCCTCGCCGTGATCGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173793051 Original CRISPR GTGTAGAGCTGCAGGGAGGG TGG (reversed) Exonic
900416126 1:2535558-2535580 GTGGAGGGCTGCAGGGAGCGGGG - Intergenic
900433252 1:2612715-2612737 GTAGAGAGATGGAGGGAGGGTGG - Intronic
900587545 1:3440431-3440453 GTGGGGAGCTTCAGGGAGTGGGG - Intergenic
900622842 1:3595294-3595316 GGGTGGAGGTGGAGGGAGGGCGG + Intronic
900782431 1:4626765-4626787 GTGCAGGGCTGCAGGGACCGAGG + Intergenic
900993275 1:6107523-6107545 GTGGAGAGATGGAGGGATGGAGG + Intronic
901637748 1:10678192-10678214 GAGACGGGCTGCAGGGAGGGCGG - Intronic
902772581 1:18654197-18654219 GTGTGGAGCTGGCGGGTGGGGGG - Intronic
902873472 1:19327544-19327566 GTGAACAGATGGAGGGAGGGAGG - Intronic
903281695 1:22253944-22253966 GGGTGGAGGTGCAGGCAGGGAGG - Intergenic
903331554 1:22599596-22599618 GTGGAGAGAGGGAGGGAGGGAGG + Intronic
903489230 1:23715324-23715346 GGGGAGAGGTGCTGGGAGGGTGG - Intergenic
903623955 1:24717991-24718013 GGGTCAAGCTGGAGGGAGGGGGG + Intergenic
904623176 1:31787782-31787804 GAGTTGGGCTCCAGGGAGGGAGG + Intergenic
905015659 1:34776930-34776952 GTCTGGGGCTGCAGGCAGGGAGG - Intronic
905204189 1:36333608-36333630 GTGTAGGGATGGAGGGAGAGCGG - Intergenic
905290744 1:36920407-36920429 GCAGAGAGCAGCAGGGAGGGGGG - Intronic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906276411 1:44519691-44519713 ATGGAGAGATGGAGGGAGGGGGG - Intronic
906472999 1:46146668-46146690 GTGTAGAGTTGGAGGGGAGGGGG - Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
906940750 1:50253091-50253113 GTGCAGAGGTGCAGGGAGTTGGG - Intergenic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907714712 1:56916168-56916190 GTAATGATCTGCAGGGAGGGAGG + Intronic
908644909 1:66266698-66266720 GTTGAGAGCTGCAGAGAGGAAGG + Intronic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
910725029 1:90328864-90328886 GTGCTGAGCTGCCTGGAGGGGGG - Intergenic
912080955 1:105935064-105935086 CTGTAGAGCTGCAGGCTGAGAGG + Intergenic
913358691 1:117954078-117954100 TTGTAAAGCTGCAGGGAAAGAGG + Exonic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
915059637 1:153170774-153170796 GTGGGGAGGTGCAGGGAGGTAGG - Intergenic
915464690 1:156089984-156090006 GTTTCGAGCTGCGGTGAGGGAGG + Intronic
915713992 1:157926734-157926756 ATGCAGAGCTCCAGGGAGGGAGG + Intergenic
916211169 1:162361007-162361029 GTGTAGAGCTGGAGGGTGCAGGG + Intronic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
916514963 1:165507642-165507664 ATGTAGAGGGGCAGGTAGGGTGG + Intergenic
916667696 1:166981487-166981509 GTGTAGAGAGGGAGGGAGGGAGG + Intronic
917439511 1:175054761-175054783 GAGTAGAGCTGGAGGGAGATGGG + Intergenic
917539352 1:175898179-175898201 CATTGGAGCTGCAGGGAGGGAGG + Intergenic
918183348 1:182105573-182105595 TTGAAGAGTTACAGGGAGGGAGG - Intergenic
918487675 1:185046016-185046038 GAGTAGGGCTGCAGAGAGGCTGG - Intronic
919132348 1:193467157-193467179 GTGAAGAGATGAAGGGAAGGTGG - Intergenic
919785994 1:201259166-201259188 GGGCAGAGCTGGAGGGAGGCAGG + Intergenic
921948861 1:220908331-220908353 CTGTAGAGCTCCAGAAAGGGTGG - Intergenic
922157800 1:223053595-223053617 GGGAAGAGCTGCAGGAATGGGGG + Intergenic
922815490 1:228446218-228446240 GTGTACAGCTGCAGAGAAGCCGG - Intergenic
923030134 1:230243207-230243229 CTGCAGAGCTGCGGGCAGGGAGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1064282508 10:13964456-13964478 GCGTGGAGCTGGAGGCAGGGTGG + Intronic
1064995797 10:21295972-21295994 GGGGAGAGCTGGAGGGAGGTGGG - Intergenic
1066040350 10:31543116-31543138 ATGTAGAGCTTCTTGGAGGGTGG - Intergenic
1067348374 10:45454548-45454570 GTGTTTTGCTGCAGGGAGGCTGG - Intergenic
1067817555 10:49493834-49493856 GTGTAGAGGAGCAGGCAGGGTGG - Intronic
1068438205 10:57017801-57017823 GAGTATAGCTGCAGGCATGGGGG + Intergenic
1068930001 10:62580217-62580239 GTATAGAGTAGCAGGGATGGTGG + Intronic
1069876491 10:71566353-71566375 GTGAAGGGCTGCCAGGAGGGAGG + Intronic
1071504676 10:86225492-86225514 GTGTATTTCTGCAGGGAAGGAGG + Intronic
1072037244 10:91574796-91574818 CTGTAGAGCTCCAGGGAGCTTGG + Intergenic
1072257216 10:93631589-93631611 TTGAAGAGCGGCGGGGAGGGAGG - Intronic
1072452166 10:95547259-95547281 GTGTGGAGGTGCAGGTAGTGAGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1075064990 10:119283296-119283318 ATGTTGAGCTGCAGGGCTGGAGG - Intronic
1075339326 10:121632994-121633016 CTGTTGGGCGGCAGGGAGGGGGG + Intergenic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076491365 10:130863862-130863884 GTGGACAGCGGCAGGGTGGGAGG + Intergenic
1076619096 10:131775633-131775655 GTGGAGAGCGGCAGAGAGGCAGG + Intergenic
1077118417 11:895879-895901 GTGGGGAGCTGCAGGAAGGTCGG - Intronic
1077173844 11:1180007-1180029 GAACAGAGCTGCAGGGAGGAAGG - Intronic
1077479923 11:2808977-2808999 ATGCAGAGATGGAGGGAGGGAGG + Intronic
1077480857 11:2813849-2813871 ACGGGGAGCTGCAGGGAGGGAGG + Intronic
1078325066 11:10373635-10373657 GTGTAGAGCTGAAGTGCAGGAGG - Intronic
1078444851 11:11396411-11396433 ATGGAGAGCTGCAGGGATGATGG + Intronic
1078631299 11:13007142-13007164 CTTTAAAGTTGCAGGGAGGGGGG + Intergenic
1078715612 11:13836437-13836459 GGGGAGTCCTGCAGGGAGGGAGG + Intergenic
1079003880 11:16779194-16779216 GAATAGGGGTGCAGGGAGGGTGG - Intronic
1079586116 11:22128469-22128491 CTGCAGAGCTACAGGGACGGAGG - Intergenic
1081157837 11:39716484-39716506 CTGTAAAGCAGCCGGGAGGGAGG + Intergenic
1081655822 11:44856829-44856851 GTGTAGGGAGGGAGGGAGGGAGG - Intronic
1081963947 11:47158121-47158143 GGGCAGGGCTGCAGGCAGGGAGG - Intronic
1083248182 11:61446459-61446481 GCGGGGAGCTGCAGGGAGGGCGG - Exonic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083419745 11:62546158-62546180 GGGCAGAGGTGCAGGGAGCGCGG + Intronic
1083899976 11:65638753-65638775 GTGTGAAGCTTCAGGGTGGGGGG + Intronic
1084676171 11:70636042-70636064 GGGTAGAGCTGAGGTGAGGGTGG - Intronic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1087635209 11:100694552-100694574 AGGTGGAGCTGCAGGGAGGCTGG - Intronic
1089401077 11:118165075-118165097 GTGGAGGGAAGCAGGGAGGGAGG - Exonic
1089458562 11:118639762-118639784 GTGTAGTGAGGCAGGGAGGGAGG - Intronic
1089610380 11:119665348-119665370 GTGTAGAGGGGGTGGGAGGGAGG + Intronic
1089764448 11:120752651-120752673 CCTGAGAGCTGCAGGGAGGGTGG - Intronic
1090963517 11:131578456-131578478 GGGGAGAGCTGCAGGGAAGTGGG + Intronic
1091119105 11:133042031-133042053 GTGCAGAGCTGGGGGGTGGGGGG + Intronic
1091128105 11:133119890-133119912 AGGTAGGGCTGCAGGGAGAGAGG + Intronic
1091686197 12:2564592-2564614 GAGTAGAGCTCCAGGCAGAGGGG - Intronic
1092242404 12:6843348-6843370 GCGTGCACCTGCAGGGAGGGTGG - Exonic
1092273830 12:7044206-7044228 GTGCACAGCAGCAGGGAGGCAGG - Intronic
1092956992 12:13560328-13560350 GTGTTGGGCTGGAGGGAGTGGGG - Exonic
1093425506 12:19024009-19024031 ATGTGGAGGTGCCGGGAGGGTGG + Intergenic
1095608919 12:44104269-44104291 ATGGAGAGATGAAGGGAGGGAGG - Intronic
1096070431 12:48772405-48772427 TAGTCCAGCTGCAGGGAGGGTGG - Exonic
1096309284 12:50505574-50505596 GGGTAGGGCTGCGAGGAGGGTGG + Intronic
1096973998 12:55688182-55688204 GTGGTGAGCTGCAGGGTTGGGGG - Exonic
1096994819 12:55831798-55831820 CTGAAGAGCTGCAGGGTGGTGGG + Intergenic
1097323497 12:58250436-58250458 GGGCAGAGATGCAGGAAGGGAGG + Intergenic
1099652855 12:85450913-85450935 GAATAGAGGTGCAGGGAGGTGGG + Intergenic
1100370716 12:93966752-93966774 GTGGAGGGATGAAGGGAGGGAGG - Intergenic
1100451715 12:94712899-94712921 GGGTAGAGCTGCAGTGGGAGTGG + Intergenic
1101929716 12:109003902-109003924 GTTTAAAACTGCAGGGAGGTTGG - Intronic
1101986514 12:109451537-109451559 GTGTAGCACGGCAGGGAGTGGGG + Exonic
1102590393 12:113952106-113952128 GTATAAACCTGCAGGGAGGGTGG + Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103383054 12:120509943-120509965 TTGTAGAGCTACAGTGAGTGAGG - Intronic
1103703621 12:122860196-122860218 GTGGAGAGCGGCAGGGTGAGGGG + Exonic
1103948719 12:124540668-124540690 GTGAAGAGCTGGAGGGAGATGGG + Intronic
1103948804 12:124540890-124540912 GTGGAGAGCTGGAGGGGGGTGGG + Intronic
1103948890 12:124541150-124541172 GTGGAGAGCTGGAGGGAGATGGG + Intronic
1103949148 12:124541884-124541906 GTGGAGAGCTGGAGGGGGAGGGG + Intronic
1104258626 12:127162397-127162419 GCATGGAGCTGCAGGGATGGAGG - Intergenic
1104420059 12:128627746-128627768 GAGCAGAGCTGCAGGGCGGGGGG - Intronic
1106097255 13:26659201-26659223 GTGTAGAGCTAGAGGAAGTGAGG + Intronic
1106146516 13:27054200-27054222 GTGTGGAGGTGCTGGGACGGAGG + Intergenic
1106314008 13:28577841-28577863 GCTGAGAGCTGAAGGGAGGGGGG - Intergenic
1108065173 13:46569937-46569959 GAGTAGAGTTGCAGAGAGGGAGG - Intronic
1112310558 13:98314091-98314113 GGGTACAGGTGCAGGCAGGGAGG + Intronic
1112506827 13:99980747-99980769 GCCTCGAGCTGGAGGGAGGGAGG + Intergenic
1112563336 13:100532594-100532616 GGGCAGAGCTGCAGGGAGAGGGG + Exonic
1113286849 13:108858980-108859002 ATGAAGACCTGAAGGGAGGGAGG - Intronic
1114617172 14:24074476-24074498 GGTGAGAGCTGCAAGGAGGGTGG - Intronic
1116808922 14:49520547-49520569 GGGTACAGATGCTGGGAGGGAGG + Intergenic
1118434372 14:65756176-65756198 GAGGTGAGCTGCTGGGAGGGGGG - Intergenic
1118540183 14:66814377-66814399 GTGAACACCTGCAGGGAGGCAGG + Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1119811408 14:77523462-77523484 GTGTACAGGAGCAGGGAGGTGGG + Intronic
1119952332 14:78758023-78758045 CTCTAAGGCTGCAGGGAGGGAGG - Intronic
1121715627 14:96071783-96071805 GTAGACAGCTGCAGGGAGGTGGG + Intronic
1121727926 14:96166493-96166515 CTGAGGACCTGCAGGGAGGGTGG + Intergenic
1121901980 14:97701591-97701613 GTGTAGGGCTGGGGTGAGGGTGG + Intergenic
1122068757 14:99191697-99191719 GTGGAGGGCTGCGGGCAGGGGGG - Intronic
1122606133 14:102948417-102948439 GTGTGGAGGTGAGGGGAGGGTGG + Intronic
1202893733 14_KI270722v1_random:183555-183577 GGGTGGCGCTGCTGGGAGGGCGG + Intergenic
1123582109 15:21725109-21725131 GTGAACACCTGCAGGGAGGCAGG - Intergenic
1123618759 15:22167705-22167727 GTGAACACCTGCAGGGAGGCAGG - Intergenic
1124400462 15:29343489-29343511 CTGTAGGGCAGCAGGGAGGCTGG - Intronic
1124617225 15:31250311-31250333 CTGTTGAGGGGCAGGGAGGGAGG + Intergenic
1124857966 15:33409402-33409424 GTAGAGAGCTGCAGAGAGAGCGG - Intronic
1125439735 15:39689245-39689267 ATGTAGAGGTGCTGGGAGGGTGG - Intronic
1126054910 15:44720922-44720944 GTGTGGAGGTGCTGGGAGGGTGG - Intergenic
1127933387 15:63612715-63612737 GGGTTGAGAGGCAGGGAGGGTGG - Intronic
1128184993 15:65637347-65637369 GTAATGAGCTGAAGGGAGGGTGG + Intronic
1128213239 15:65916734-65916756 GTCCAGACCAGCAGGGAGGGAGG - Intronic
1128838125 15:70827854-70827876 GTATGGAGCGGGAGGGAGGGTGG + Intergenic
1129325955 15:74800397-74800419 GTGTAGTGCTGCAGGGTGTGGGG - Exonic
1129737560 15:77974676-77974698 GTGGAGAGGGGCTGGGAGGGTGG - Intergenic
1129848508 15:78778940-78778962 GTGGAGAGAGGCTGGGAGGGTGG + Intronic
1130271949 15:82456350-82456372 GTGTAGAGTCACAGAGAGGGAGG - Intergenic
1130464299 15:84183737-84183759 GTGTAGAGTCACAGAGAGGGAGG - Intergenic
1130488387 15:84411082-84411104 GTGTAGAGTCACAGAGAGGGAGG + Intergenic
1130499967 15:84489798-84489820 GTGTAGAGTCACAGAGAGGGAGG + Intergenic
1130541491 15:84823475-84823497 GGGGAGAGCTGGAGGGTGGGTGG + Intronic
1130586594 15:85188372-85188394 GTGTAGAGTCACAGAGAGGGAGG - Intergenic
1130955704 15:88626059-88626081 GTGGTGCACTGCAGGGAGGGAGG + Intronic
1131110471 15:89761545-89761567 GTGGTGAGGTGCTGGGAGGGTGG + Intronic
1131178465 15:90224669-90224691 GTGCAGAGGAGCAGGGAGTGTGG + Intronic
1131522248 15:93125454-93125476 GTGTGGAGCTACAGGAGGGGAGG + Intergenic
1132144794 15:99423318-99423340 GTGTAGCTCTGGAGGGAGTGGGG - Intergenic
1132279807 15:100602827-100602849 GGGCAGAGGTGCAGGGAGGCAGG - Exonic
1132744621 16:1431552-1431574 GGGGAGGGCTTCAGGGAGGGAGG - Intergenic
1132909401 16:2300746-2300768 GGGCAGAGCAGCAGGGAAGGTGG + Intronic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1132954678 16:2585426-2585448 GTGCGGCCCTGCAGGGAGGGAGG - Intronic
1133099136 16:3468658-3468680 GTGGAGCGATGCAAGGAGGGAGG - Intronic
1133429769 16:5726395-5726417 GTCTAGGGCCCCAGGGAGGGAGG - Intergenic
1133875002 16:9725750-9725772 GTACAGAGCTCCTGGGAGGGAGG - Intergenic
1133978586 16:10617568-10617590 GTGTAGGGGTGAAGGGAGGAGGG - Intergenic
1134588666 16:15434583-15434605 GTTGCGGGCTGCAGGGAGGGAGG - Exonic
1135480593 16:22817758-22817780 GTGCAGAGTTGCAGGCAGTGTGG + Intronic
1135590364 16:23700828-23700850 CTGGGGAGCTGCTGGGAGGGAGG + Intronic
1136117466 16:28103836-28103858 GTAGGGAGCTGGAGGGAGGGTGG + Intronic
1136227072 16:28866416-28866438 CTTGAGAGCTGCAGGGTGGGTGG + Exonic
1136636720 16:31528998-31529020 GTGCAGAGCTGCAGGGGAGGGGG + Intergenic
1137534873 16:49312582-49312604 TGGAAGAGCTGCAGGGTGGGGGG - Intergenic
1139127653 16:64099252-64099274 GTGAAGAGCTACAGGGAGACAGG - Intergenic
1139474733 16:67197494-67197516 GTGTGGAGCCTCAGGGTGGGTGG + Intronic
1139561267 16:67743891-67743913 CTGTGGAGCAGCAGTGAGGGTGG - Intronic
1139597661 16:67967885-67967907 GTGTAGATCTGTAGGGACAGTGG - Intronic
1139647864 16:68344915-68344937 GTGTAGAGATGCAGGAAGGGAGG - Intronic
1139667635 16:68468879-68468901 GTGGAGAGGTGGAGGGAGGTAGG + Intergenic
1140533202 16:75684464-75684486 GTGTAAGTCTGCAGGGATGGCGG + Intronic
1140970046 16:80004169-80004191 GCGTAGACATGCAGAGAGGGAGG - Intergenic
1141193962 16:81845685-81845707 GTGCAGAGCTGCACAGAGAGCGG - Intronic
1141591510 16:85072179-85072201 TTTTAGAGATGCGGGGAGGGGGG - Intronic
1141888147 16:86907341-86907363 ATTTAGGGCTGGAGGGAGGGTGG - Intergenic
1141888447 16:86909886-86909908 GAGTAGAGCTGCAGGTGGGGAGG + Intergenic
1142378196 16:89717557-89717579 GTGAAGGGCAGCAGGGAGGTGGG - Intronic
1142590495 17:1003345-1003367 GGGCAGAGCTGCGGGGAGGTGGG - Exonic
1142610630 17:1107800-1107822 GAGTGGAGCTGTAGGGAGGCTGG - Intronic
1144274626 17:13653684-13653706 GGGTAGGGCTGCCGGGACGGTGG + Intergenic
1146935657 17:36811176-36811198 GTGGGGAGCAGGAGGGAGGGAGG - Intergenic
1148035254 17:44655535-44655557 TTGTAAAGCTGAAGGGCGGGGGG - Intergenic
1148163509 17:45465763-45465785 CTATAGAGCTGCAAGGAGGCCGG + Intronic
1149914525 17:60596998-60597020 TTGTAAAGCTGCTGGGAGTGGGG + Intergenic
1151676867 17:75603123-75603145 GCCTAGAGCTGTGGGGAGGGAGG - Intergenic
1151771334 17:76164066-76164088 GTGTAGAGCAGCTGGGTAGGAGG - Intronic
1152226822 17:79096626-79096648 GTGTAGCCCCGCCGGGAGGGAGG - Intronic
1152378215 17:79929469-79929491 GTAGAGAGCTGCAGGGAGCCCGG + Intergenic
1152754561 17:82081864-82081886 GGGCAGAGCTGCGGGGAGGTCGG + Intronic
1153016323 18:585314-585336 AGGTAGAGCTGCAGGAAAGGAGG - Intergenic
1153315464 18:3717089-3717111 GTATAAAGCTGCTGGGATGGAGG - Intronic
1153754372 18:8264926-8264948 GTCTAGAGTTGCAGGCAGGCTGG + Intronic
1153835345 18:8959046-8959068 GGGAGGTGCTGCAGGGAGGGAGG + Intergenic
1155323689 18:24644588-24644610 GTGTACAAATGAAGGGAGGGTGG + Intergenic
1156034875 18:32754952-32754974 GTGTAGATCTGCAGCAAGGGAGG + Intronic
1156747176 18:40406483-40406505 CTGTAGAGCTGCAAGGAATGTGG - Intergenic
1157381849 18:47225777-47225799 GTGCAGAGGTGGAGGGAGAGGGG + Intronic
1157762395 18:50274343-50274365 GTGTAGGGCTGCTGGGGTGGGGG + Exonic
1159556797 18:69954451-69954473 GGGTAGAGGTGCAGGTAGAGAGG + Intronic
1160047959 18:75405491-75405513 GTGTAGAGGTGGAGGGTTGGGGG + Intergenic
1160526288 18:79540334-79540356 GAGGAGAGCTGCCCGGAGGGAGG - Intergenic
1160535881 18:79591096-79591118 GAGGAGAGCTGCAGGGTGGGGGG - Intergenic
1160672662 19:373629-373651 GTGTGGAGTTGCTGGGAGAGGGG + Intronic
1160738948 19:677201-677223 GGGTGGGGCTGCAGGGATGGGGG - Intronic
1160806044 19:992592-992614 GTGCTGAGCTGCAGGGAGTGAGG - Intronic
1160815485 19:1033839-1033861 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815520 19:1033979-1034001 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815642 19:1034471-1034493 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815659 19:1034541-1034563 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815676 19:1034611-1034633 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160991387 19:1861740-1861762 GTGGAGAGCAGGAGGGCGGGTGG - Intronic
1161064198 19:2229498-2229520 GAGATGAGCTGCAGGTAGGGTGG + Intronic
1161101568 19:2424421-2424443 GGGGAGGGCTGCAGGGAGCGAGG - Intronic
1161326785 19:3667974-3667996 CTGGAGAGGGGCAGGGAGGGCGG - Intronic
1161458019 19:4379671-4379693 GTGCAGAGGTGCAGGGAGGGCGG - Intronic
1162458868 19:10802607-10802629 GTTCAGATCTGCAGGGAGAGGGG + Intronic
1162917419 19:13881784-13881806 GTGTAAGGCTGCAGGGTGGGAGG + Intergenic
1163284726 19:16339213-16339235 TTGTACAGATGCAGGGAGGGAGG - Intergenic
1164557996 19:29268377-29268399 GTGGGCAGCTCCAGGGAGGGCGG + Intergenic
1164609312 19:29621403-29621425 GTGCAGAGCTGAACGCAGGGAGG - Intergenic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1166144337 19:40823922-40823944 GGGTGGGGCTTCAGGGAGGGAGG + Intronic
1166654044 19:44596974-44596996 GCGGAGAACTGCAGGGCGGGAGG + Intergenic
1166742454 19:45122639-45122661 GTGAAGACCTGCAGGCAGGGAGG + Intronic
1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG + Intergenic
1166881589 19:45933644-45933666 GGGTGGAGGTGCAGGGAGGAGGG + Intergenic
1167190212 19:47982939-47982961 GTTAGGAGCTGGAGGGAGGGAGG + Intronic
1167612278 19:50513293-50513315 TTCTGGAGCTGCAGGGAAGGGGG + Exonic
1168099620 19:54134141-54134163 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1168099669 19:54134278-54134300 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
925295009 2:2770378-2770400 GTGCAGAGCTGCATGGAGCAGGG - Intergenic
925611477 2:5706085-5706107 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611484 2:5706107-5706129 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611491 2:5706129-5706151 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611525 2:5706240-5706262 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611532 2:5706262-5706284 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611539 2:5706284-5706306 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611546 2:5706306-5706328 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
926243706 2:11106648-11106670 TTGTAGAGATGGAGGGCGGGGGG - Intergenic
927459824 2:23288709-23288731 CTGTGGAGCTACAAGGAGGGAGG - Intergenic
930105787 2:47638329-47638351 GTGTAGAGCAGTGGGGAGGGTGG - Intergenic
932337719 2:70940361-70940383 ATGTAAAGATGCAGGGTGGGTGG - Exonic
932369344 2:71174567-71174589 GTGGAGAGCTGCAGAGGGGAAGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932485168 2:72080411-72080433 GTGGTGGGCTGCAGGGATGGGGG - Intergenic
932808161 2:74800418-74800440 GGGGAGAGCTGCAGGAAGTGTGG + Intergenic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
933509705 2:83224767-83224789 GTGTAGAGCTGAAAGAAAGGGGG + Intergenic
936713858 2:115162243-115162265 GTGGAGAGCCGCGGGGAAGGGGG + Intronic
936926100 2:117738387-117738409 GGGTAGAGCTACAGGGCGGTAGG - Intergenic
937850309 2:126626541-126626563 GTGTGGAGGTACTGGGAGGGTGG - Intergenic
937914019 2:127090139-127090161 TTGCAGAGCTGCAGGCAAGGAGG - Intronic
937920105 2:127122730-127122752 GAGGAGAGCTGGAGGGAGGGGGG + Intergenic
938337310 2:130511363-130511385 CTGAGGAGCAGCAGGGAGGGAGG - Intergenic
938352528 2:130609372-130609394 CTGAGGAGCAGCAGGGAGGGAGG + Intergenic
938662950 2:133506113-133506135 ATGCTGAGGTGCAGGGAGGGTGG - Intronic
938769901 2:134492506-134492528 GGCTAGAGGTGGAGGGAGGGAGG - Intronic
941508411 2:166376061-166376083 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
942441625 2:176042916-176042938 GTGTAGAACAGCAGAGAGTGAGG - Intergenic
942488384 2:176463901-176463923 GTGCAGTGCTGCACAGAGGGTGG + Intergenic
943637882 2:190326326-190326348 TGGTAGAGCTTCAGGGAGAGGGG - Intronic
943666568 2:190615488-190615510 ATGTGGAGGTGCAGGGAGGCCGG - Intergenic
944977830 2:205077160-205077182 GAGTAGAGAGGGAGGGAGGGAGG + Intronic
945468001 2:210192833-210192855 GTGTACAGCTCCATGGAGGTTGG - Exonic
946081958 2:217128161-217128183 GGGTGGAGCTGCTGGGAGAGTGG + Intergenic
948139339 2:235661249-235661271 GTTGAGGGCTGGAGGGAGGGAGG + Intronic
948364241 2:237444452-237444474 CAGGAGAGCTGCTGGGAGGGAGG - Intergenic
948650660 2:239441380-239441402 TTCTAGGGCAGCAGGGAGGGAGG + Intergenic
948995479 2:241576166-241576188 GAGTAGAGCTGCAGGGAAGGAGG - Intergenic
949043708 2:241860727-241860749 GGGAAGAACTGCAGGGAGAGAGG - Intergenic
1168965295 20:1894873-1894895 GGGTCGGGCTGCCGGGAGGGCGG + Intronic
1169637903 20:7714984-7715006 GTGGAGGGAGGCAGGGAGGGAGG + Intergenic
1170450084 20:16474005-16474027 GCTTGGAGCAGCAGGGAGGGAGG - Intronic
1171029418 20:21663894-21663916 GTATGGAGCTGGAGGGAAGGAGG + Intergenic
1171283060 20:23917522-23917544 GCCTACAGCTGCAGTGAGGGAGG - Intergenic
1171327428 20:24307659-24307681 GTGTAGGACTGCAGGGAAAGAGG - Intergenic
1171497385 20:25565411-25565433 GGGAAGAGAGGCAGGGAGGGAGG + Intronic
1172013386 20:31859427-31859449 GTGCAAAGGTGCAGGGAGTGGGG - Intronic
1173567359 20:44051494-44051516 GAGTGGAGCTGGAGGGAGAGGGG - Exonic
1173656950 20:44705986-44706008 CTGAAGAGAGGCAGGGAGGGAGG - Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1174442441 20:50566842-50566864 GTGGAGAGCTGCAGTGACTGGGG + Intronic
1174469349 20:50744644-50744666 GTGAAAAGCAGGAGGGAGGGAGG - Intronic
1174619035 20:51859901-51859923 CTGGACAGCTGCAGGGATGGAGG + Intergenic
1174993077 20:55534855-55534877 TTGTAAAGCTGAAGGGAGAGAGG - Intergenic
1175223801 20:57433289-57433311 CTGTGGAGCTGCAGAGGGGGAGG - Intergenic
1175316766 20:58054140-58054162 GAGTAGAGAGGGAGGGAGGGAGG + Intergenic
1175676575 20:60951254-60951276 CTGGAGAGGTGCGGGGAGGGCGG + Intergenic
1175748813 20:61480615-61480637 GTGTGGAGGTGTGGGGAGGGCGG + Intronic
1175935045 20:62510406-62510428 GTGGAGGGGTGCAGGGATGGAGG - Intergenic
1175972276 20:62692666-62692688 GTGTAGAGGAAGAGGGAGGGAGG + Intergenic
1176110278 20:63407754-63407776 CTGGAGAGGTACAGGGAGGGGGG + Intronic
1177968056 21:27753710-27753732 GAGAAGAGCAGCAGGGAGGAAGG - Intergenic
1178437718 21:32574567-32574589 TTGCAGAGCTGCAGGTAGGTGGG - Intergenic
1179963410 21:44785013-44785035 GGGTGTAGCTGCAGAGAGGGTGG - Intronic
1180167988 21:46040036-46040058 GGGAAGGGCTGGAGGGAGGGTGG - Intergenic
1181550818 22:23638259-23638281 GGGTTGAGCTGCAAGGAGGAAGG + Intergenic
1181790631 22:25263022-25263044 TGGGAGAGTTGCAGGGAGGGGGG - Intergenic
1182072270 22:27472102-27472124 GTCCAGAGGTGGAGGGAGGGAGG - Intergenic
1182158565 22:28099037-28099059 CTATAAAGCTGCAAGGAGGGAGG + Exonic
1182682916 22:32096432-32096454 GTGGAGAGCTGCAGTGTGAGGGG - Intronic
1182757339 22:32690669-32690691 GTGGAGGGATGCAGGGAAGGTGG - Intronic
1182827614 22:33279313-33279335 GAGCATAGCTGCAGGGAGAGAGG + Intronic
1183646903 22:39132299-39132321 GAGCAGAGCTGCGAGGAGGGCGG + Exonic
1183774066 22:39951255-39951277 GTGTGTAGCTGCAGGTATGGTGG - Intronic
1184543286 22:45145137-45145159 GCTAAGGGCTGCAGGGAGGGGGG - Intergenic
1184658742 22:45955581-45955603 GTGCAGAGATGCTGGGAGCGGGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184981023 22:48096230-48096252 GTGGGGAGGTGCAGGCAGGGTGG + Intergenic
1185125707 22:49009585-49009607 TTGTAGGCTTGCAGGGAGGGTGG + Intergenic
1185380368 22:50505032-50505054 GGGTAGCGCTGCAGGGCTGGGGG - Intronic
1185421911 22:50739479-50739501 GTGTAGGGATGCACTGAGGGAGG + Intronic
949408087 3:3735496-3735518 ATGGACAGCTGCATGGAGGGAGG + Intronic
949478024 3:4467140-4467162 GTGTGGAGCGGCAGGGAGCCAGG - Exonic
949970057 3:9396970-9396992 GTGTAGAGATGCTGGGTGTGCGG - Intergenic
950071308 3:10155021-10155043 GTGTAGAGGTTCCTGGAGGGTGG + Intergenic
950439956 3:13004730-13004752 GTGAGGGGCTGCAGGGATGGAGG + Intronic
951007250 3:17632212-17632234 GTAAAGAACTGCAGGCAGGGTGG + Intronic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952627501 3:35424687-35424709 GTGTGGCGCTGCAGAAAGGGAGG + Intergenic
953020847 3:39112154-39112176 CTGTAGGGGTACAGGGAGGGAGG + Intronic
953179343 3:40581898-40581920 GTGTCCTGCTGCAGGGAGGGTGG + Intergenic
953320173 3:41964173-41964195 GTGTGCAGCTGCAGGCATGGGGG + Intergenic
953642272 3:44720169-44720191 GAGAAAAGGTGCAGGGAGGGAGG - Intronic
954326519 3:49867077-49867099 GAGTAGAGCAGCAGAGAGGAGGG - Intronic
954459064 3:50616261-50616283 GTCTAGAGCCATAGGGAGGGTGG - Intronic
954791192 3:53134758-53134780 GGGCAGAGGAGCAGGGAGGGAGG + Intergenic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955645978 3:61137851-61137873 GTGTGAGGCTGCAGGGAGAGAGG - Intronic
956012922 3:64850726-64850748 GTCCAGAGTTGCAGAGAGGGAGG + Intergenic
956493493 3:69799298-69799320 ATGAAGAAATGCAGGGAGGGAGG + Intronic
956566286 3:70642183-70642205 GTGTGTAGATGCAAGGAGGGTGG - Intergenic
959295732 3:104531577-104531599 GTGAATGCCTGCAGGGAGGGAGG + Intergenic
959990006 3:112621086-112621108 GGGTATAGCTATAGGGAGGGGGG - Intronic
960641029 3:119823299-119823321 GGGTAGAGATGGCGGGAGGGAGG + Intronic
961000623 3:123371786-123371808 GTGTAGATATGCAGGGGTGGGGG - Intronic
962250766 3:133834728-133834750 GAGTAAAGCTGCAGGTTGGGAGG - Intronic
962407367 3:135111508-135111530 CTAGAAAGCTGCAGGGAGGGGGG + Intronic
962796031 3:138850345-138850367 TTGGAGAGCTGCCAGGAGGGTGG + Intergenic
963085342 3:141430641-141430663 GTGCAGAGGGGCAGGGAGTGGGG + Intronic
963214114 3:142724900-142724922 GTGTGGAGCTGGCGGGAGAGTGG + Intronic
963782540 3:149501335-149501357 GAGGAGAGATGAAGGGAGGGAGG - Intronic
965882083 3:173397986-173398008 GTGAAGAGCTGCAGTGACTGGGG - Intronic
966344619 3:178964831-178964853 GTGTAGAGGAGCTGGGAGGATGG + Intergenic
966647429 3:182262283-182262305 GAATATAGCTGCATGGAGGGAGG - Intergenic
968074889 3:195810805-195810827 ATGTAAAGCTGCAGGGTGAGAGG - Intronic
968232480 3:197011943-197011965 AGGGAGAGGTGCAGGGAGGGAGG - Intronic
968292671 3:197550740-197550762 GGGTGGAGGTGGAGGGAGGGAGG + Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
968867709 4:3224530-3224552 GGGGAGAGGTGCAGGGAGCGGGG - Intronic
968970620 4:3791682-3791704 GAGTGGAGGTGCAGGGATGGAGG - Intergenic
968983532 4:3863565-3863587 GTGTAGAGCTGTAGGCATGCAGG + Intergenic
969234009 4:5852484-5852506 GAGGAGAGAAGCAGGGAGGGAGG - Intronic
969263438 4:6048213-6048235 GTGTAAGGCTGCAGGTAGGAGGG + Intronic
969625666 4:8304094-8304116 GTCTGGTGCTGGAGGGAGGGAGG + Intronic
969699703 4:8761437-8761459 TTGTGGGGCTCCAGGGAGGGTGG - Intergenic
970419084 4:15888364-15888386 CTGTAGAGCTGGAATGAGGGTGG - Intergenic
970591179 4:17561807-17561829 GTGTAGAGGGGCGGGGAGGCTGG + Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972702418 4:41507196-41507218 GTGTGGAGGTGCTGGGAGGATGG - Intronic
973068339 4:45825066-45825088 GTGTTGGGGTGGAGGGAGGGGGG + Intergenic
973104237 4:46313014-46313036 GTTTAGAGCTGCTTGGAGAGGGG + Intronic
974424890 4:61729050-61729072 TTGTAGAGAGGGAGGGAGGGGGG + Intronic
974953000 4:68604212-68604234 CTGTAAAGTAGCAGGGAGGGAGG + Intronic
974994163 4:69131938-69131960 GTCTAGGGCAGCAGGGAGTGGGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
978503977 4:109436828-109436850 ATGTGGAGATGCTGGGAGGGTGG + Intronic
978818971 4:112943336-112943358 ATGGAGAGAGGCAGGGAGGGAGG - Intronic
981044080 4:140250576-140250598 GGGAAGAGGTGCAGGGAGGGAGG + Intergenic
982522030 4:156430004-156430026 GAGTATAGATGCAGGGAAGGGGG + Intergenic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
982930125 4:161394052-161394074 GTATAGAGCTACATGGAGTGAGG + Intronic
985117438 4:186605555-186605577 GAGAAGAGGTGGAGGGAGGGGGG + Intronic
985725309 5:1513042-1513064 GTGCAGAGCCCCACGGAGGGAGG + Intronic
987342134 5:16948622-16948644 GTGTAGAGCTCCAGAGAGGTAGG + Intergenic
988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG + Intergenic
989360652 5:40597807-40597829 ATGTAGGGCCGCAGGGAGGCTGG + Intergenic
990640941 5:57782637-57782659 GTGAAGTCCTGCAGGGAGGCAGG - Intergenic
991502567 5:67291543-67291565 GTGGAAAACTGCAGTGAGGGTGG - Intergenic
992678955 5:79134078-79134100 GAGGAGAGAGGCAGGGAGGGAGG + Intronic
994558167 5:101331111-101331133 GTGCAGAGCTGCAGGTGGGCTGG - Intergenic
997237969 5:132285235-132285257 GGGTACAGCTGCAGGTACGGGGG + Intronic
997449162 5:133968170-133968192 GTGTAGATGGGCGGGGAGGGAGG - Intronic
997870750 5:137503291-137503313 GTGGAGGGTTGCAGGGAGGGTGG - Intronic
998614205 5:143721576-143721598 GGGTAGAGAGGAAGGGAGGGAGG - Intergenic
998813895 5:145993241-145993263 GTGTAAAGCAGCTGGGAGGAAGG - Intronic
1000334049 5:160228884-160228906 GTGTAGAGAAGCAGGAAGGTTGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000833673 5:166131581-166131603 GTGTAGGGATGGAGGGAGAGTGG + Intergenic
1001779429 5:174355078-174355100 TTGTAGAGCTGCAGGTAAGTAGG + Intergenic
1001820434 5:174705948-174705970 GTGGAGAGAGGCAGGGAGGGTGG - Intergenic
1002071291 5:176680236-176680258 GAGTTGAGCTGCAGGGCGGGAGG - Intergenic
1002887186 6:1308240-1308262 GTGGAGAGAGGCAGGGAGGCAGG - Intergenic
1003098894 6:3162547-3162569 CAGAAGAGCTCCAGGGAGGGAGG - Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1004848649 6:19673623-19673645 GGTTACAGCTGCAGGAAGGGAGG - Intergenic
1005662779 6:28016379-28016401 GAGTACACCTGCAGGGATGGGGG - Intergenic
1005685134 6:28246650-28246672 GAGGAAAGCTGCGGGGAGGGGGG - Intronic
1006799095 6:36748184-36748206 GGGTAGAGGAGCAGGGTGGGAGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007183502 6:39947941-39947963 GTGTAGGGAGGGAGGGAGGGGGG + Intergenic
1007476225 6:42121754-42121776 GTGTGGAGTTGCAGAGTGGGAGG + Intronic
1007725585 6:43913834-43913856 GTGGGCAGCTGGAGGGAGGGAGG + Intergenic
1007776446 6:44226940-44226962 GTGGAGAGCAGGAGGGAAGGAGG - Intronic
1008134058 6:47752786-47752808 GTGTGAAGCCACAGGGAGGGAGG - Intergenic
1011556122 6:88572997-88573019 GTCCACAGCTGCAGGGAGAGTGG + Intergenic
1012375941 6:98561567-98561589 GTAGAGAGATGGAGGGAGGGAGG - Intergenic
1013661864 6:112306233-112306255 GAGAAGAGATGGAGGGAGGGAGG - Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1018434960 6:163751429-163751451 GATTAGGGCTGCGGGGAGGGAGG - Intergenic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019443066 7:1057037-1057059 GTCCTGAGCTGCCGGGAGGGAGG + Intronic
1019479715 7:1260994-1261016 GTGGAGAACGCCAGGGAGGGAGG - Intergenic
1019722074 7:2578619-2578641 GTGAAGAGCAGCAGGCAGGGGGG + Intronic
1019764695 7:2841990-2842012 GGGTAGAGAGGTAGGGAGGGAGG + Intronic
1020036516 7:4966614-4966636 TTGTGGAGGTGCCGGGAGGGTGG + Intergenic
1020164841 7:5799668-5799690 ATGTGGAGATGCCGGGAGGGTGG - Intergenic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1020787561 7:12590331-12590353 GTGTAGGGATGGAGGGAGAGTGG + Intronic
1021508652 7:21411681-21411703 GTGAATAGCTGTAGGGTGGGAGG - Intergenic
1022647112 7:32241883-32241905 GAGTGCAGATGCAGGGAGGGTGG + Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1024013160 7:45287867-45287889 ATGTGGAGGTGCTGGGAGGGTGG - Intergenic
1024081649 7:45861611-45861633 GTTTAGATCTGCAGGGTGGGTGG - Intergenic
1024225467 7:47323032-47323054 GTGCAGAGCTGCAGGTGGGCTGG - Intronic
1024288117 7:47777930-47777952 GTGAGGAGCTGCAGGGGAGGTGG + Intronic
1026539836 7:71270038-71270060 GTGTAGGGCAGCAGGGAGGTAGG - Intronic
1029188190 7:98754395-98754417 GAGTCAGGCTGCAGGGAGGGGGG - Intergenic
1029303516 7:99602202-99602224 GATTGGAGCTGCAGGGAGGGTGG - Intronic
1029792374 7:102858276-102858298 GGGAAGAGTGGCAGGGAGGGAGG + Intronic
1030058857 7:105607273-105607295 GTGGAGAGTTGGAGGGTGGGTGG - Exonic
1030623502 7:111817996-111818018 ATCTAGAGCTGCTGGGAGGTTGG - Intronic
1030692212 7:112547297-112547319 GACTGGAGCTGCAGGGATGGCGG + Intergenic
1030809216 7:113955238-113955260 GTGAACACCTGCAGGGAGGCAGG - Intronic
1031630130 7:124034199-124034221 GGGGAGAGGTGAAGGGAGGGAGG - Intergenic
1031743943 7:125469028-125469050 GTGGTGGGCTGCAGGGCGGGGGG + Intergenic
1032470682 7:132176234-132176256 GTGCAGGGGTGCAGGGAGAGAGG - Intronic
1032470684 7:132176242-132176264 GTGTAGAGGTGCAGGGGTGCAGG - Intronic
1032494717 7:132352384-132352406 GAGTAGAGCCCCAGGGAGGGAGG + Intronic
1032724688 7:134580007-134580029 AAATAGAGATGCAGGGAGGGAGG + Intergenic
1033118147 7:138644632-138644654 GTGGAAGGCTGGAGGGAGGGGGG - Intronic
1033370901 7:140706685-140706707 GTGGAGAGGTGGTGGGAGGGGGG + Intronic
1033420217 7:141198855-141198877 GTGTGGGGCCGCAGGCAGGGTGG + Intronic
1033604656 7:142917803-142917825 TTGTAGAGCAGCAAGGAAGGGGG - Intronic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035170343 7:157013950-157013972 CTGTAAAGCTGCATGGAGAGAGG + Intergenic
1035421120 7:158729660-158729682 GTGTGGAGGTGCTGGGGGGGAGG + Intergenic
1035421139 7:158729717-158729739 GTGTGGAGGTGCTGGGGGGGAGG + Intergenic
1035519691 8:266466-266488 GTGTGCAGCTGCAGAGGGGGCGG + Intergenic
1036194499 8:6702016-6702038 GTGAAGAGTTGCAGGGAGAAGGG - Intergenic
1036226339 8:6960962-6960984 GAGCAGAGCTGCAGGGCTGGGGG - Intergenic
1037034008 8:14143779-14143801 CTGCAGAGATGTAGGGAGGGTGG - Intronic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1037806193 8:22059021-22059043 GTGGGGAGGGGCAGGGAGGGTGG - Intronic
1038266940 8:26045241-26045263 GTGGGGAGGAGCAGGGAGGGGGG - Exonic
1038476935 8:27875202-27875224 GTGAAGAGAGGGAGGGAGGGAGG - Intronic
1038697379 8:29818462-29818484 GTGGTGAGATGCAGGGAGGTGGG + Intergenic
1039191752 8:34984062-34984084 GACTGGAGCTGCAGAGAGGGAGG - Intergenic
1042532577 8:69831335-69831357 GTCCAGAGCAGCAGGGATGGTGG - Intronic
1042559406 8:70061800-70061822 GTGAAGAGCTAGGGGGAGGGAGG - Intronic
1043984910 8:86682633-86682655 GTGGAGAGCTCCTGGAAGGGAGG + Intronic
1047252698 8:123192715-123192737 GTGCAGAGGGGAAGGGAGGGAGG - Intronic
1047480773 8:125280921-125280943 TTGTAGGGCAGCAGGCAGGGAGG - Intronic
1047993586 8:130312324-130312346 GGGTTCAGCTGCAGGGATGGTGG - Intronic
1048150755 8:131891132-131891154 GGGCAGAGTTGCAGGGAGCGAGG + Intergenic
1048513685 8:135085707-135085729 GTGTAGAACAGCAGGGACAGGGG + Intergenic
1049418404 8:142505893-142505915 GTGGGCAGCTGCAGGGAGGTGGG + Intronic
1049724630 8:144139988-144140010 GCTGAGAGCTGCAGGGAGTGAGG - Exonic
1050744185 9:8857912-8857934 GGGTAGGGGTGGAGGGAGGGCGG - Intronic
1053142733 9:35691137-35691159 GTGGAGAGCCGCCGGGAGGAGGG + Intergenic
1053534049 9:38908247-38908269 TTCATGAGCTGCAGGGAGGGTGG - Intergenic
1054206273 9:62132666-62132688 TTCATGAGCTGCAGGGAGGGTGG - Intergenic
1054632084 9:67455680-67455702 TTCATGAGCTGCAGGGAGGGTGG + Intergenic
1055300026 9:74873086-74873108 ATGTAGAGATGGAGGCAGGGAGG - Intronic
1055672381 9:78620391-78620413 AATTGGAGCTGCAGGGAGGGGGG - Intergenic
1055694273 9:78866283-78866305 GTGTTGAGCTATTGGGAGGGAGG + Intergenic
1056987393 9:91375987-91376009 GTGCAGAGCCCCAGGGAGAGGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057603715 9:96482657-96482679 GGCCAGGGCTGCAGGGAGGGAGG - Intronic
1057702987 9:97376978-97377000 GTGGAGGGATGAAGGGAGGGAGG - Intronic
1057817509 9:98306440-98306462 GAGGTGGGCTGCAGGGAGGGAGG + Intronic
1057845770 9:98521309-98521331 GTGCGGTGCTGCAGGGAGGGTGG + Intronic
1058171805 9:101690508-101690530 GTGCAGAGCTGCAGGGAGAGAGG + Intronic
1061213923 9:129209313-129209335 GAGGAGGGCTGCAGAGAGGGAGG + Intergenic
1061265175 9:129500633-129500655 GCCTAGAGCAGCAGGGAGGCAGG - Intergenic
1061566840 9:131446403-131446425 GTGACAAGCTGGAGGGAGGGCGG + Exonic
1061668598 9:132175100-132175122 GTGCAGAGACGCAGGGAAGGGGG + Intronic
1062000178 9:134211956-134211978 GTGCAGGGGGGCAGGGAGGGTGG - Intergenic
1062425993 9:136506500-136506522 GTGCAGGGGTGCAGGGAGGCAGG - Intronic
1062614331 9:137389170-137389192 GTGCTCAGCTGCAGGCAGGGCGG + Intronic
1186359623 X:8826755-8826777 GTGGTTACCTGCAGGGAGGGAGG + Intergenic
1186660822 X:11665775-11665797 GTGTAGAGCTGGAGGAATGCCGG + Intergenic
1186834973 X:13428711-13428733 GTTGAGAGCTGCTGGGACGGTGG - Intergenic
1187825846 X:23333462-23333484 GTGTTGAGCCGCAGGGGGCGCGG - Intergenic
1188722631 X:33542503-33542525 GTGGAGAGGTGCAGGATGGGTGG - Intergenic
1189023261 X:37364704-37364726 GTGGATAGGTCCAGGGAGGGAGG - Intronic
1189137280 X:38562306-38562328 GTGTAAGGATGCAGGGAGGTGGG - Intronic
1189294847 X:39910849-39910871 GTGCAGAGCTGCAGGGAACAGGG + Intergenic
1189348948 X:40262852-40262874 GTGTGGGGCAGCGGGGAGGGAGG + Intergenic
1189536592 X:41941319-41941341 CTGTCCAGTTGCAGGGAGGGTGG + Intergenic
1190236107 X:48616956-48616978 CTGCACAGCTGCAGGGAGTGCGG - Intergenic
1190298657 X:49043298-49043320 GTGGCGAGCTGGGGGGAGGGGGG - Exonic
1190330053 X:49230365-49230387 GTGCAGGCCTGCGGGGAGGGAGG + Exonic
1191693203 X:63961926-63961948 GTGTAGTCCTGCATGGAGGCAGG + Intergenic
1191881688 X:65848976-65848998 GTGTGGAGTTGCTGGAAGGGTGG + Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1195418537 X:104647173-104647195 CTGCAGAGGTGCAGGCAGGGTGG + Intronic
1199814646 X:151386851-151386873 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1200135795 X:153873997-153874019 GTGTGAAGGTCCAGGGAGGGAGG + Intronic
1201438609 Y:13985520-13985542 GTGTAGGGAGGGAGGGAGGGAGG - Intergenic
1201445964 Y:14057188-14057210 GTGTAGGGAGGGAGGGAGGGAGG + Intergenic
1202370921 Y:24194901-24194923 GTGTAGAGTCACAGAGAGGGAGG + Intergenic
1202499863 Y:25475216-25475238 GTGTAGAGTCACAGAGAGGGAGG - Intergenic