ID: 1173793644

View in Genome Browser
Species Human (GRCh38)
Location 20:45843801-45843823
Sequence CAGTCTGCACACCCATGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173793644_1173793649 23 Left 1173793644 20:45843801-45843823 CCCGTGCATGGGTGTGCAGACTG 0: 1
1: 0
2: 1
3: 23
4: 179
Right 1173793649 20:45843847-45843869 CTACAGTGTGTGTGTGTGATAGG 0: 1
1: 1
2: 11
3: 63
4: 590
1173793644_1173793647 -1 Left 1173793644 20:45843801-45843823 CCCGTGCATGGGTGTGCAGACTG 0: 1
1: 0
2: 1
3: 23
4: 179
Right 1173793647 20:45843823-45843845 GGTTGCTGCACAAGAGCGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 64
1173793644_1173793651 25 Left 1173793644 20:45843801-45843823 CCCGTGCATGGGTGTGCAGACTG 0: 1
1: 0
2: 1
3: 23
4: 179
Right 1173793651 20:45843849-45843871 ACAGTGTGTGTGTGTGATAGGGG 0: 1
1: 0
2: 12
3: 114
4: 1004
1173793644_1173793650 24 Left 1173793644 20:45843801-45843823 CCCGTGCATGGGTGTGCAGACTG 0: 1
1: 0
2: 1
3: 23
4: 179
Right 1173793650 20:45843848-45843870 TACAGTGTGTGTGTGTGATAGGG 0: 1
1: 0
2: 3
3: 65
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173793644 Original CRISPR CAGTCTGCACACCCATGCAC GGG (reversed) Intronic
900309596 1:2027284-2027306 CAGCCTTCACACCCAGGCCCTGG - Intronic
900889931 1:5442242-5442264 CATTCTGCCCACACAGGCACTGG - Intergenic
902404883 1:16177133-16177155 GAGACTGGCCACCCATGCACTGG + Intergenic
902547938 1:17201863-17201885 CATCCTGCACACCCATGCTGTGG - Intergenic
903222366 1:21875968-21875990 CGGGCTCCACACCCCTGCACGGG - Exonic
908208319 1:61873802-61873824 CAGGCTGGAGACCCATGCACTGG + Intronic
908255472 1:62299952-62299974 CAGGCTGCACACACATGCCGAGG - Intronic
908783527 1:67713231-67713253 CAGTCTGCACAGGCATGCACAGG - Intronic
910194367 1:84624949-84624971 CAGTTTGGACACCCAGCCACCGG + Intergenic
910866010 1:91788684-91788706 GACGCTGCACACGCATGCACTGG + Intronic
912253808 1:108038732-108038754 CAGTCTGCACTCCCATTCTGGGG - Intergenic
915111960 1:153569530-153569552 CAGTCTGCACCCCCCAGCAAAGG - Intergenic
916037091 1:160932014-160932036 CAGTCTGCCCACCCAGGGATCGG - Intergenic
916818473 1:168375503-168375525 CTGTCTGCACACCCTTGATCTGG - Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
919417043 1:197323816-197323838 CAGCCTACACACCTAAGCACAGG - Intronic
923109674 1:230880529-230880551 CAGTGTGCCCACCCATGGACAGG + Intergenic
1063050208 10:2439042-2439064 AAGGCTTCACACCCATGAACTGG - Intergenic
1063372735 10:5532319-5532341 GAGGCGGCACAGCCATGCACAGG + Intergenic
1064129263 10:12693549-12693571 CAGCCTCGACACCCATGCTCAGG - Intronic
1065420377 10:25537146-25537168 CAGACTGCATACTCATGCAGAGG + Intronic
1067729018 10:48795727-48795749 CAGTCTGCCCAGCCATCCATTGG - Intronic
1067737337 10:48868211-48868233 CAGGCTGCACATCCATGAATGGG - Intronic
1068261976 10:54594664-54594686 CTGTCTGCAAACACATGTACAGG - Intronic
1069071988 10:63998641-63998663 CAGACTGCACTCCCATGCATTGG - Intergenic
1070158866 10:73853401-73853423 CAGGCTGCATAGCCTTGCACTGG - Intronic
1075071788 10:119324708-119324730 CATACTGCTCAGCCATGCACTGG - Intronic
1075319448 10:121478285-121478307 CAGTCAGCACCTCCAAGCACAGG + Intergenic
1076083122 10:127601241-127601263 CAGGTTGCACACCCTGGCACGGG - Intergenic
1076287283 10:129312549-129312571 CAGTCTGCACATTCCAGCACGGG + Intergenic
1076384100 10:130044890-130044912 CAATCCGCACACCTATGCGCAGG - Intergenic
1076534316 10:131167166-131167188 CTGCCTGCACACACAGGCACAGG - Intronic
1077429489 11:2508983-2509005 GACTCTGCACACCCTTGCCCAGG - Intronic
1078537339 11:12185585-12185607 CAGTCTGCTCATCCATGAAATGG - Intronic
1082224634 11:49689994-49690016 CAGCCTGCACTCCCATGGATAGG - Intergenic
1084038777 11:66529807-66529829 CCTTCTCCACAGCCATGCACCGG + Exonic
1084399305 11:68934480-68934502 CAGTTTGCACATCCAGGCTCTGG + Exonic
1084426479 11:69086974-69086996 CACCCTGGACACCCAGGCACAGG - Intronic
1084565846 11:69928340-69928362 CAGCCCCCACACCCACGCACAGG - Intergenic
1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG + Intronic
1090998182 11:131885806-131885828 AAGTCTGCTCACACTTGCACTGG - Intronic
1091432801 12:451180-451202 CTGCCTGCCCACGCATGCACTGG + Intergenic
1091767186 12:3129271-3129293 CTGCCTGCACACCCACCCACAGG + Intronic
1091850479 12:3693122-3693144 CTGCCTGCACACACATGCACCGG + Intronic
1092264192 12:6968678-6968700 CAGGCTGTACACCATTGCACAGG - Intronic
1095085436 12:38054112-38054134 CTGTCCGCACTCCCATGCTCTGG - Intergenic
1098290206 12:68950923-68950945 CAGACTGCAGACCCAAGCACCGG + Intronic
1099370699 12:81826255-81826277 AAGTCTGCACACCTATTCAGCGG - Intergenic
1099548950 12:84018950-84018972 CAGTCTCCACCCCCATTGACTGG - Intergenic
1101515025 12:105426600-105426622 CATTCTGCACATCCAAGAACAGG + Intergenic
1101803251 12:108041149-108041171 CAGTCTGCACACAGATCCACTGG + Intergenic
1104716387 12:131019027-131019049 AAGTGTGCACACCCGGGCACAGG - Intronic
1104881637 12:132075370-132075392 CAGTCTCCAAACCTAAGCACAGG - Intronic
1110370088 13:74730000-74730022 CAGTCTCTACACCGATACACAGG + Intergenic
1112401389 13:99081561-99081583 CAGTCAGCATGCCCATGCAAAGG + Intronic
1115154470 14:30322187-30322209 AATTCTGCACTCCAATGCACAGG - Intergenic
1117988223 14:61409191-61409213 CAGTGTGCATGCCCATGAACAGG - Intronic
1118466962 14:66039850-66039872 CAGTTTGCATTCCCATGGACTGG + Intergenic
1118571570 14:67200026-67200048 CATTCTGGACACCCAGGCTCTGG + Intronic
1119110716 14:71971351-71971373 CACTCTGCAAAACCTTGCACTGG + Intronic
1119708459 14:76803193-76803215 CACACTGCACATCCATGCAATGG + Intronic
1121121950 14:91381504-91381526 CAGTCTGCAGTCCCCTGCAGGGG - Intronic
1122122022 14:99559846-99559868 CAGCCAGCACACCCCTGCCCGGG + Intronic
1123114309 14:105886963-105886985 CAAGATGCACACCCATGCACAGG - Intergenic
1125163696 15:36677970-36677992 CAGTCTGAACACTCATGCTTTGG + Intronic
1125736079 15:41926814-41926836 CTGTCTCCACACCCTTGCTCAGG + Intronic
1128775030 15:70313727-70313749 CAGTCTGCAGACACAGGCCCTGG - Intergenic
1128866724 15:71119930-71119952 AGCTCTGCATACCCATGCACTGG - Intronic
1132066007 15:98731966-98731988 CAGTCTTCACCCCCAAGCTCTGG + Intronic
1132891981 16:2209083-2209105 CAGGCTGCACACTCCTGGACTGG + Exonic
1133254913 16:4510863-4510885 CAGTCTGCACACGCAGGTTCTGG - Exonic
1133321392 16:4915813-4915835 CAGTTTCCACACCCATAAACGGG - Intronic
1134248012 16:12554384-12554406 GACGATGCACACCCATGCACGGG - Intronic
1134634797 16:15784173-15784195 CGCACTGCACACGCATGCACAGG + Intronic
1135633923 16:24057869-24057891 CACTCTTCACACCCAGCCACAGG + Intronic
1139586755 16:67908918-67908940 CAGTATGCACACCCCTGCCCCGG + Exonic
1140128434 16:72136945-72136967 CACTCCGCACACCCATCCCCTGG - Intronic
1147875238 17:43616344-43616366 GAGACTGCACACCCAGGCCCTGG - Intergenic
1148667184 17:49383465-49383487 CAGTCTGCCCACCCCTGGCCTGG + Intronic
1148860574 17:50602345-50602367 GACTCTGCACCCCCAGGCACAGG - Intronic
1149121271 17:53168662-53168684 CAGTTTTCACACCCATACAGTGG + Intergenic
1149737924 17:59013951-59013973 CAAGCTGCACACACTTGCACAGG + Intronic
1149910769 17:60564882-60564904 CAGTCTGCACCCTCAGGCAGAGG + Intronic
1154206755 18:12344082-12344104 GCATCTGCTCACCCATGCACTGG + Intronic
1154478917 18:14797316-14797338 CTGACTGCACATCCATTCACAGG + Intronic
1160021303 18:75183898-75183920 TTGTCTGCCCACCCATGCCCCGG + Intergenic
1160621866 18:80176845-80176867 CAGGATACACACACATGCACGGG + Intronic
1161171142 19:2813029-2813051 GAGTCTGCACACCCTCGCCCAGG - Intronic
1162460101 19:10809840-10809862 CTATCTGCACACCCAGGCCCTGG - Intronic
1163625308 19:18386176-18386198 CAACCTGCACAGCCATGCCCGGG + Exonic
1164895397 19:31873045-31873067 CATTCTGCTTACCCATGCATAGG + Intergenic
1167351154 19:48975554-48975576 CAGTCTCCACCCCCATTGACTGG - Intronic
1168648527 19:58077441-58077463 TAATCTGCACACCAAGGCACTGG + Intronic
925165578 2:1713709-1713731 CAGTCTGTGCCCCCATGCTCCGG - Intronic
928461011 2:31472641-31472663 GAGTCTGCACAGCCATTCAAAGG + Intergenic
933051903 2:77611252-77611274 CAGGCTGCACACCATGGCACTGG - Intergenic
933700156 2:85249325-85249347 GACTCTGCTCACCCATGCAAGGG - Intronic
934981823 2:98849424-98849446 CCCTCTGCACACCCACCCACAGG - Intronic
938337949 2:130515769-130515791 CAGACTGCACACCAATGTTCTGG - Intergenic
938351890 2:130604969-130604991 CAGACTGCACACCAATGTTCTGG + Intergenic
939214698 2:139220846-139220868 TAATCTGCCCACCCATGCATGGG - Intergenic
940408464 2:153332782-153332804 CATTCTGAGCACCCATGCATTGG - Intergenic
944512099 2:200475075-200475097 CAGTTTTCACACCCATCCGCTGG + Intronic
945046048 2:205782826-205782848 CAGTCTGAACACTCATCAACAGG - Intronic
945440902 2:209878224-209878246 CATGCTTTACACCCATGCACAGG - Intronic
947989010 2:234472579-234472601 CAGGTTGCACACCCATGAAGTGG + Intergenic
948501785 2:238399745-238399767 CGGTATGCACACCCATGCAAAGG - Exonic
948794726 2:240396474-240396496 CAGTCTCCACACACCTGAACAGG - Intergenic
949005487 2:241644473-241644495 CAGTCTCCTCACCCATGAAATGG - Intronic
1173793644 20:45843801-45843823 CAGTCTGCACACCCATGCACGGG - Intronic
1174751075 20:53112002-53112024 CTGTCTCCACACCCATGTCCCGG + Intronic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1176800677 21:13426663-13426685 CTGACTGCACATCCATTCACAGG - Intergenic
1178724497 21:35038847-35038869 CAATGTGCACATCCATGCAGAGG - Intronic
1179577812 21:42318562-42318584 CAGTCTGCTCCCCCATGCCGGGG + Intergenic
1179908361 21:44435595-44435617 CACTCTCCACACCCATCCACGGG + Intronic
1179908375 21:44435647-44435669 CACTCTCCACACCCATCCACGGG + Intronic
1179908388 21:44435699-44435721 CACTTTCCACACCCATCCACGGG + Intronic
1179908401 21:44435751-44435773 CACTCTCCACACCCATCCATGGG + Intronic
1179908414 21:44435803-44435825 CACTCTCCACACCCATCCACGGG + Intronic
1180615400 22:17122717-17122739 CAGTCTGCACAGCCAATCCCTGG + Intronic
1182528983 22:30940883-30940905 CAGGTGGCACACCCAAGCACAGG + Intronic
1183250675 22:36728170-36728192 CACACTGCCCACACATGCACAGG - Intergenic
1184657827 22:45950713-45950735 CAGTTTCCACACCCATGAAATGG + Intronic
1184775790 22:46622035-46622057 CAGTCTGCTCTCCCAGCCACCGG - Intronic
1185204835 22:49531900-49531922 CAGTCTGTACACCCACGGAGAGG - Intronic
949497263 3:4644296-4644318 CTCTCAGCACACGCATGCACTGG - Intronic
951295825 3:20933599-20933621 AAGTCTGCACACCCAGGGAAAGG - Intergenic
952855859 3:37770383-37770405 CAGTGTTCAAACCCAGGCACAGG + Intronic
956901616 3:73722335-73722357 CAGGCTGCAGACCTATACACAGG + Intergenic
958481126 3:94647339-94647361 CAGACTGCACGCCCATTCATAGG - Intergenic
960705554 3:120477479-120477501 CAGTTTGCACCACCATGCACGGG - Intergenic
961554083 3:127685691-127685713 CAGCCTGGCCACCCATGCAGAGG - Intergenic
963389659 3:144644085-144644107 CAGGCAGCTCTCCCATGCACAGG - Intergenic
965090273 3:164152841-164152863 CAGTCAGCAGACTCATGCACAGG + Intergenic
968233981 3:197021061-197021083 CAATTTGCAAACCCCTGCACTGG - Intronic
969302002 4:6302559-6302581 CAGTCTGCACACGTGGGCACAGG - Exonic
972409521 4:38778878-38778900 CAGTGGGCACGCCCATCCACAGG + Intronic
980508249 4:133752000-133752022 CAGTCTGCACACCTATGTCCTGG - Intergenic
982223207 4:153142139-153142161 CTGGCTGCACACCTGTGCACAGG - Intergenic
990855963 5:60266630-60266652 CAGTATGCACACCCATGTTTGGG - Intronic
995024467 5:107403146-107403168 CAGTCTCCAGAACCATCCACAGG + Intronic
996108841 5:119540330-119540352 AACTCTGCACTGCCATGCACCGG - Intronic
997527807 5:134564696-134564718 CAGTCTGCAGCCCCATGGAGGGG - Intronic
999475661 5:151896210-151896232 CAGTCTGGTCACCCAGCCACTGG + Intronic
1002662014 5:180797667-180797689 AAGTCTGCACACACATGGAGTGG + Intronic
1003145513 6:3506960-3506982 CAGTGTGCATACACATACACAGG - Intergenic
1003646023 6:7913345-7913367 AAATCTACACACCCCTGCACAGG + Intronic
1004984755 6:21068595-21068617 CAGTCTTTCCACCCATACACAGG + Intronic
1005004309 6:21272483-21272505 CATTTTGTACACCCATGAACAGG + Intergenic
1006960910 6:37928972-37928994 CAGTCTGCCCACCTATGTAATGG + Intronic
1007701651 6:43769604-43769626 CCGTCTGCACACCCCGGCTCTGG - Intergenic
1007996539 6:46314075-46314097 CAGTCACCACACCCAGCCACTGG - Intronic
1008592145 6:53005177-53005199 CAGTCTGTCCGGCCATGCACTGG + Exonic
1013358402 6:109368910-109368932 CAGCCTGCACACCCAAGACCAGG + Exonic
1015325527 6:131919042-131919064 CAGACTACACTCCCATGCACTGG - Intergenic
1015386017 6:132624394-132624416 CAATCTGCACGCCCAAGCAGTGG - Intergenic
1015691105 6:135924429-135924451 CAGACTGCTCACCTATACACAGG - Intronic
1015923373 6:138287226-138287248 CAGTATGCACACACCTGCACAGG + Intronic
1021270735 7:18582027-18582049 CAGTCTGCATGCACAGGCACAGG + Intronic
1023192945 7:37602330-37602352 CATTCTGCACAGCTATGTACAGG - Intergenic
1023620824 7:42070470-42070492 CAGACTCCACACCCTTGCTCCGG - Intronic
1023860136 7:44213548-44213570 CAGTCTGCCCACCTGTGCTCAGG + Exonic
1024761942 7:52609366-52609388 CAGTGTGCACACCGAGGCATTGG - Intergenic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1025994272 7:66518385-66518407 CAGTCTGCACATCCCTGCAATGG - Intergenic
1026033727 7:66816280-66816302 CGGTCTGCACATCCCTGCAATGG + Intergenic
1026985886 7:74555074-74555096 CAGTCTACACAGCCCTGCAATGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035564786 8:634503-634525 ACGTCTGCACACCCATGCTCAGG + Intronic
1035649009 8:1250317-1250339 CGGTGTGCAGACCCAGGCACTGG - Intergenic
1036900941 8:12668688-12668710 CACTCTGCACAGCCGTGCAAGGG - Intergenic
1038179274 8:25211329-25211351 CAGTTTTATCACCCATGCACTGG + Intronic
1040540319 8:48347834-48347856 CAGACTGCACTCCCTTGCACTGG - Intergenic
1041680612 8:60585885-60585907 CAGTCTGCATTTCCATGGACAGG + Intronic
1045287624 8:100805465-100805487 CAGTTTCCTCCCCCATGCACTGG - Intergenic
1048007379 8:130430535-130430557 CAGTCTCCATCCCCATGCCCAGG - Intronic
1048063394 8:130943695-130943717 CACTCTACACAGCCCTGCACAGG - Intronic
1051173301 9:14341257-14341279 CAACCTGCACAACCAAGCACGGG - Intronic
1053306359 9:36986940-36986962 CCCTCTGGACACCCAGGCACTGG - Intronic
1053320043 9:37089468-37089490 CAATCTTTACACACATGCACAGG + Intergenic
1053533578 9:38904953-38904975 CAGCCTGCACACCCTCGCTCAGG + Intergenic
1054205803 9:62129382-62129404 CAGCCTGCACACCCTTGCTCAGG + Intergenic
1054632558 9:67458988-67459010 CAGCCTGCACACCCTCGCTCAGG - Intergenic
1056484238 9:87038679-87038701 CAGTCTGAATATCAATGCACTGG - Intergenic
1057428767 9:94975906-94975928 GAGTCTGCACACTACTGCACTGG + Intronic
1057444001 9:95101128-95101150 CAGACAGCACACCCAAGCCCGGG - Exonic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1061921706 9:133786226-133786248 CACTGGGCACACTCATGCACAGG - Intronic
1062044111 9:134417339-134417361 GAGGCTGCCCACCCCTGCACAGG - Intronic
1062357008 9:136169857-136169879 CAGTGTGCACAGCCAGGCAGAGG + Intergenic
1062376599 9:136264556-136264578 CAGGCCACAGACCCATGCACAGG - Intergenic
1062498086 9:136840964-136840986 GAGTCTGCACACCCGTGTTCAGG - Exonic
1062533087 9:137010305-137010327 CAGGACGCACACCCAGGCACAGG + Exonic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1192237093 X:69302857-69302879 CTGTCTGCTCACCCATCCACTGG - Intergenic
1194201704 X:90959257-90959279 CGGGCTGCACACCCAAGCCCTGG - Intergenic
1194329251 X:92560643-92560665 CTGGCTGAACACCCATGAACTGG + Intronic
1194761839 X:97804173-97804195 CAGGCTGTACAAGCATGCACTGG + Intergenic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic
1199729312 X:150615356-150615378 AAGTCTGCAAAGCCCTGCACTGG - Intronic
1200547543 Y:4534712-4534734 CGGGCTGCACACCCAAGCCCTGG - Intergenic
1200637951 Y:5679832-5679854 CTGGCTGAACACCCATGAACTGG + Intronic