ID: 1173794401

View in Genome Browser
Species Human (GRCh38)
Location 20:45848951-45848973
Sequence CACACTGCTCAGAGAAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173794401_1173794406 22 Left 1173794401 20:45848951-45848973 CCTTCACTTCTCTGAGCAGTGTG 0: 1
1: 0
2: 1
3: 26
4: 305
Right 1173794406 20:45848996-45849018 TCATGGTGCTCATCGCTTACAGG 0: 1
1: 0
2: 0
3: 4
4: 70
1173794401_1173794404 -5 Left 1173794401 20:45848951-45848973 CCTTCACTTCTCTGAGCAGTGTG 0: 1
1: 0
2: 1
3: 26
4: 305
Right 1173794404 20:45848969-45848991 GTGTGCTTATTTGCAAACTGGGG 0: 1
1: 0
2: 0
3: 45
4: 552
1173794401_1173794402 -7 Left 1173794401 20:45848951-45848973 CCTTCACTTCTCTGAGCAGTGTG 0: 1
1: 0
2: 1
3: 26
4: 305
Right 1173794402 20:45848967-45848989 CAGTGTGCTTATTTGCAAACTGG 0: 1
1: 0
2: 2
3: 63
4: 669
1173794401_1173794403 -6 Left 1173794401 20:45848951-45848973 CCTTCACTTCTCTGAGCAGTGTG 0: 1
1: 0
2: 1
3: 26
4: 305
Right 1173794403 20:45848968-45848990 AGTGTGCTTATTTGCAAACTGGG 0: 1
1: 0
2: 1
3: 65
4: 619
1173794401_1173794405 5 Left 1173794401 20:45848951-45848973 CCTTCACTTCTCTGAGCAGTGTG 0: 1
1: 0
2: 1
3: 26
4: 305
Right 1173794405 20:45848979-45849001 TTGCAAACTGGGGATCATCATGG 0: 1
1: 0
2: 2
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173794401 Original CRISPR CACACTGCTCAGAGAAGTGA AGG (reversed) Intronic
900566989 1:3338417-3338439 TTCACTGCTCAGATAACTGAAGG - Intronic
900977365 1:6025978-6026000 CACACTGCTGGCAGCAGTGAGGG + Intronic
900981520 1:6048739-6048761 CACAGACCTCAGGGAAGTGAGGG + Intronic
902257557 1:15199862-15199884 CCCACTTCGCAGAGAAGTCAGGG - Intronic
902362083 1:15947410-15947432 CACACTGCACAGGGAACAGAAGG + Intronic
902520806 1:17014816-17014838 CACACTGCTCAGGTCAGGGAGGG - Intergenic
902613346 1:17609940-17609962 CACACTGCCCAGAGCAGGGCTGG - Intronic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
903189683 1:21649763-21649785 CACACTCCGGCGAGAAGTGAAGG + Exonic
903742539 1:25566656-25566678 CAAACAGCTCAGAAAAGTCAGGG - Intronic
904444672 1:30559277-30559299 CACACCACTCAGATAAGGGATGG - Intergenic
905174576 1:36127498-36127520 GGCACTGCCCAGAGAAGGGAGGG + Intergenic
906777471 1:48542992-48543014 CCCACTGTTCAGAGAAGATAAGG + Intronic
907427277 1:54388331-54388353 GCCAGGGCTCAGAGAAGTGAAGG - Intronic
907790569 1:57659571-57659593 CACACTGGTCAGGGAAGGGGAGG - Intronic
907860787 1:58351122-58351144 ACCACTGCTCAAAGAAATGAGGG - Intronic
907942829 1:59105770-59105792 CTCACTGCTCAGAAATCTGAAGG - Intergenic
909369111 1:74863145-74863167 AACACTGCTCAAAGAAATCAGGG - Intergenic
909706476 1:78590941-78590963 CACTGGGCTCAGAGAAGTTAAGG + Intergenic
909714951 1:78696694-78696716 GACACTGCTCAAAGAAATCAGGG - Intergenic
910601298 1:89035170-89035192 CACAGTGATCAGAGTGGTGAAGG + Intergenic
911162313 1:94693542-94693564 GACAATGCTAAGAGAACTGATGG - Intergenic
913087472 1:115452104-115452126 CAGAGTGCTCACAGAAGTGGAGG - Intergenic
913118413 1:115717651-115717673 CACACGGCTAAGAGAAGAAAAGG - Intronic
915816125 1:158967422-158967444 AACACTGCTCAAAGAAATGAAGG + Intronic
917135410 1:171784243-171784265 CACACAGCTCAAAGATCTGAAGG - Exonic
917272189 1:173289303-173289325 CACAGCGCTCACATAAGTGAGGG + Intergenic
917906318 1:179589578-179589600 CAAGCTCCTCAGAGAAGGGATGG - Intergenic
919208397 1:194448211-194448233 GACACTGCTTAGAGAAGTGTAGG - Intergenic
919761944 1:201103637-201103659 GCCACTGTACAGAGAAGTGATGG - Intronic
920329000 1:205191354-205191376 CACACTGCTCAGTGATGTGGTGG + Intronic
921095256 1:211881575-211881597 AACACTGCTCAAAGAAATCAGGG - Intergenic
921635048 1:217482396-217482418 TACACTGAGCAGAGAATTGAAGG + Intronic
922357096 1:224786754-224786776 CACAATGGTCAGAGCAGTTAGGG - Intergenic
1066881689 10:40722593-40722615 CACACAACACAAAGAAGTGACGG - Intergenic
1067091024 10:43265990-43266012 CTCACTGCTCTGAGCAGGGAGGG + Intronic
1067763817 10:49070477-49070499 CCAGCTGCTCAGACAAGTGAAGG - Intronic
1068331678 10:55579303-55579325 CACAATTATCATAGAAGTGAGGG + Intronic
1070873890 10:79783505-79783527 CACATTACCCAGAGAACTGAGGG + Intergenic
1071568419 10:86683475-86683497 CTGCCTGCTCAGGGAAGTGAGGG + Intronic
1071640822 10:87305644-87305666 CACATTACCCAGAGAACTGAGGG + Intergenic
1071654414 10:87432292-87432314 CACATTACCCAGAGAACTGAGGG - Intergenic
1071987156 10:91063384-91063406 CACATGGCCCAGAGAAGAGAAGG + Intergenic
1073581895 10:104675970-104675992 AACACTGCTGAGAGAAATTAAGG - Intronic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075654140 10:124150368-124150390 CACACAGCTCAGAGTAGGGCTGG + Intergenic
1075975689 10:126691988-126692010 AATACTGGGCAGAGAAGTGAGGG - Intergenic
1077131646 11:975943-975965 CACACTCCTCAGAGAGGAGGAGG - Intronic
1077416588 11:2426880-2426902 GACACGGCTCAGGGAAGTGGTGG + Intergenic
1078724979 11:13922015-13922037 CACAATGCTCAGAGATCTGAGGG - Intergenic
1079644951 11:22851629-22851651 TACATTCATCAGAGAAGTGAGGG + Intronic
1080412526 11:32039179-32039201 CAAACTGGACAGAGAAGAGATGG - Intronic
1080952971 11:37057562-37057584 AACACTGCTCAAAGAAATCAGGG - Intergenic
1082764887 11:57159487-57159509 CACAGTGGTCAGTGCAGTGATGG - Intergenic
1083614968 11:64021739-64021761 CACACTTGTCAGAGAACAGAAGG - Intronic
1083971907 11:66082906-66082928 GACACTCCTCAAAGATGTGAAGG - Intronic
1086536675 11:87855200-87855222 CTGACTGCTCAGAGAAATGCAGG - Intergenic
1086908550 11:92445502-92445524 CACATTACTCAGAGAACAGAGGG + Intronic
1086962553 11:92994038-92994060 AACACTGCTGAGAGAAATTAAGG + Intergenic
1089994550 11:122893296-122893318 CACACTCCTCAGAGCAGGCATGG + Intronic
1090213415 11:124939241-124939263 CAGAGTGCTCAGAGAAGGCAGGG - Intergenic
1090793664 11:130115040-130115062 AACAGGGTTCAGAGAAGTGAAGG - Intronic
1091251265 11:134146185-134146207 CCCACTGCACAGTGAAGGGAAGG + Intronic
1091343198 11:134835804-134835826 AAGAATGCTCAGAGAGGTGAAGG + Intergenic
1091614356 12:2037737-2037759 GACCATGCTCTGAGAAGTGAGGG - Intronic
1091783857 12:3230670-3230692 CACACTGCTCTGGGAACTGAGGG + Intronic
1091847958 12:3672023-3672045 CCCAAAGCTCAGAGAAGGGAAGG - Intronic
1095028274 12:37175919-37175941 CACACAGCACAAAGAAGTTACGG - Intergenic
1096649276 12:53054003-53054025 CACTCTGCCCAGGTAAGTGAGGG + Exonic
1098823197 12:75259426-75259448 CTGACTGCTCAGGGAAGTGGTGG + Intergenic
1099017204 12:77358426-77358448 CACACTGCTCAGAGCAAGGCAGG - Intergenic
1100285706 12:93164615-93164637 TACAGGGCTCAGAGAACTGAGGG + Intergenic
1100675194 12:96858720-96858742 AACACTGCTCAAAGAAATCAGGG + Intronic
1103733058 12:123041503-123041525 CACACTGCTCTGATACGGGAGGG - Intronic
1103827038 12:123747288-123747310 CACACAGCTCAGAGACTGGAAGG - Intronic
1104296270 12:127517051-127517073 CACACTGCCCAGTGACCTGAAGG - Intergenic
1107318600 13:39161319-39161341 CACATTGGTTATAGAAGTGAAGG - Intergenic
1108892718 13:55280672-55280694 CACACTACTCAGCAAAGTGGGGG - Intergenic
1109369252 13:61399951-61399973 CCCACTGCTCAGAAAAGGGCTGG - Intergenic
1110768765 13:79310990-79311012 AACACTTTTCAGATAAGTGAAGG + Intergenic
1110907853 13:80915714-80915736 AACACTGCTCAAAGAAATCATGG + Intergenic
1111622810 13:90746294-90746316 GCCACTGCTCTGAAAAGTGATGG - Intergenic
1112176406 13:97029703-97029725 AACACTGCTCTGAAAAATGAAGG - Intergenic
1113800334 13:113083082-113083104 CAAACAGCTCAGAGGAGTGGAGG - Intronic
1114658449 14:24330008-24330030 CACACTGCTCAGGAAACTGCGGG - Exonic
1114701477 14:24682615-24682637 CACAGTCCTCGGAGAACTGAAGG + Intergenic
1115256946 14:31413213-31413235 CACACTGCTCTAAGAACTGATGG + Intronic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1121011618 14:90523266-90523288 CTCACTGATCAGAGAAGGGCGGG + Intergenic
1121743327 14:96269047-96269069 CCCACTGCAGAGAGCAGTGAAGG - Intergenic
1121811996 14:96899654-96899676 CACAGTGCGGAGAGAAATGATGG - Intronic
1121910317 14:97784434-97784456 AACCCTCCTCAGAGAGGTGACGG - Intergenic
1122046091 14:99025106-99025128 CACAGTGATCTGTGAAGTGAAGG + Intergenic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1124637809 15:31376008-31376030 AACACAGCTCAGACCAGTGAGGG + Exonic
1124859764 15:33427695-33427717 CTGACTGCTCGGAGATGTGAGGG - Intronic
1126355900 15:47795630-47795652 CACAGTGCTCAAAGAAGCCAAGG + Intergenic
1128937320 15:71757897-71757919 CACAGTGCTCAGCGGAGTGTGGG + Exonic
1129341472 15:74889269-74889291 TACAAAGCTCAGAGCAGTGAAGG + Intergenic
1129636857 15:77328724-77328746 CACAATTCACAGAAAAGTGATGG + Intronic
1130794464 15:87194306-87194328 CACACTGCTCAGCAAAGTTTAGG - Intergenic
1130983398 15:88828448-88828470 CACACATCTAACAGAAGTGAGGG - Intronic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1133840671 16:9406530-9406552 CCCACTGCTCAGCTCAGTGAGGG - Intergenic
1135098011 16:19580509-19580531 CACACAACTCACAGGAGTGAAGG - Intronic
1135821543 16:25691043-25691065 CATTTTGCTCAGGGAAGTGAGGG - Intergenic
1136128239 16:28200987-28201009 GACACAGGGCAGAGAAGTGAGGG - Intronic
1136948371 16:34684329-34684351 CACACAGCTCAAAGAGGAGAAGG + Intergenic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1141190353 16:81820284-81820306 CAGACTGCAGAGGGAAGTGAGGG - Intronic
1141887218 16:86900708-86900730 CACACTTCTAAGACAAGTAATGG - Intergenic
1142139467 16:88466325-88466347 CATTCTCCTCAGAGAACTGAAGG + Intronic
1142593266 17:1017043-1017065 CGCCCTGCCCAGAGAAGGGATGG + Intronic
1143992544 17:10978768-10978790 CACACTGCTGAGAGAGATGGTGG - Intergenic
1145254459 17:21315025-21315047 ATCTCTGCTCAGAGAAGTGCAGG + Exonic
1145322138 17:21772936-21772958 TTCTCTGCTCAGAGAAGTGCAGG - Intergenic
1146431155 17:32796283-32796305 AACACTGCTCAGGAAAATGAAGG + Intronic
1148584432 17:48767365-48767387 CACCATGCTCAGAGAAGAGCTGG - Intronic
1148767299 17:50046805-50046827 CACACAGCAGAGAGAAGGGAGGG - Intergenic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1149434233 17:56619708-56619730 CTCACTGCTCCGAAGAGTGAGGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151808417 17:76421225-76421247 AACACTGCAGAAAGAAGTGACGG + Intronic
1151852177 17:76697547-76697569 GACTCTGATCAGTGAAGTGATGG - Intronic
1152091800 17:78251330-78251352 CACCCTGCTCATAGACGTGGAGG + Intergenic
1152535436 17:80948127-80948149 AGCACGGCTGAGAGAAGTGAAGG + Intronic
1203183228 17_KI270729v1_random:85809-85831 CACACAGCTCAGAGAGGAGCAGG + Intergenic
1153082622 18:1246558-1246580 AACACAGTCCAGAGAAGTGAAGG + Intergenic
1153352191 18:4093195-4093217 AACACAGCTTAGAAAAGTGAAGG + Intronic
1153576602 18:6528060-6528082 CACACTGCTAAAAGCAGTCAAGG - Intronic
1155105657 18:22663261-22663283 AACACTGATGAGAGAAATGATGG + Intergenic
1155524428 18:26702120-26702142 CACAGTGCTCGGAGGAGAGATGG + Intergenic
1155799809 18:30087363-30087385 CAATCTGTACAGAGAAGTGATGG + Intergenic
1156937746 18:42731379-42731401 CTTAGTGCTCAGAGAGGTGAAGG + Intergenic
1157080097 18:44515284-44515306 ATCACAGCTCAGAGAAATGAAGG + Intergenic
1157146237 18:45165491-45165513 GAAACTTCTCACAGAAGTGATGG - Intergenic
1157312891 18:46565507-46565529 CACAAAGCTCAGAGCAGTGCTGG + Intronic
1157439434 18:47698994-47699016 CACAAAACTCAGAGAAGTGCTGG - Intergenic
1157744169 18:50120411-50120433 AACACTGCCCTGAGAATTGAGGG - Intronic
1157803885 18:50643845-50643867 CAGACTGCACAGTGAGGTGAGGG - Intronic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1159566760 18:70059937-70059959 CACATTGCTGAAAGAAGAGATGG + Exonic
1160408019 18:78656121-78656143 CACATTGCAGAGAGAAGTAAGGG + Intergenic
1164336932 19:24333664-24333686 CACACTGCTCAATTAAGAGAAGG - Intergenic
1164337145 19:24337398-24337420 CAAACTGCTCAAAGAAAGGAAGG - Intergenic
1164643280 19:29841876-29841898 CACAGTGATTAGAGAAGGGATGG - Intergenic
1165219168 19:34300815-34300837 CACACAGCTCAAAGATGTGCAGG + Exonic
1166868243 19:45854168-45854190 CACAGTGCTCAAACAGGTGAGGG - Exonic
1167521687 19:49959357-49959379 CACACTGCACAGAGAGGTCCAGG + Exonic
1167523696 19:49971365-49971387 CACACTGCACAGAGAGGTCCAGG - Intergenic
1167756372 19:51415895-51415917 CACACTGCACAGAGAGGTCCAGG + Exonic
1168471471 19:56643718-56643740 CACACAGCTCAGAAGAGTGGGGG - Intronic
1202681701 1_KI270712v1_random:11121-11143 CACACAGCTCAAAGAGGAGAAGG + Intergenic
925175304 2:1779215-1779237 CACACAGCTCAGGGCAGTGCTGG + Intergenic
925203926 2:1990874-1990896 CACACTGCTCTGGGATGTGTTGG + Intronic
925311735 2:2889605-2889627 CGCACTGTGCAGAGAAGCGAGGG + Intergenic
926195252 2:10759829-10759851 CACTTTGCTCAGAGAGGTCAAGG + Intronic
926196472 2:10766384-10766406 CACTTTGCTCAGAGAGGTCAAGG + Intronic
927290859 2:21403589-21403611 CAAGCTGCTGTGAGAAGTGAAGG - Intergenic
927423485 2:22956481-22956503 CACACTGCTCAGGGAGATCAGGG - Intergenic
927948609 2:27152549-27152571 GACCCTGATCAGAGCAGTGATGG + Intronic
928218934 2:29386567-29386589 CTCTCTGCTCTGAGAAATGATGG + Intronic
928224128 2:29432837-29432859 TTCACTGCTCAGTGAAGTGGGGG + Intronic
928234693 2:29529403-29529425 CATAGTGCTCAGAGCAGCGAGGG - Intronic
928299990 2:30116521-30116543 CACACTGCTCAAAGCAGCAAGGG - Intergenic
928357489 2:30632678-30632700 TACAGTGCTTAGAGAAGTGTTGG - Intronic
928720899 2:34119667-34119689 CACACACCCCAGAGAAGGGAAGG + Intergenic
928732023 2:34242490-34242512 AACACCGCACAAAGAAGTGAAGG - Intergenic
929278318 2:40049627-40049649 GACACCGCTGAGAGAAGTGTGGG + Intergenic
929468844 2:42170221-42170243 CAAAATGCTCAGAGAAGTGGAGG - Intronic
930028507 2:47044273-47044295 CACACTGCCCAGAGAATCAAGGG - Intronic
931058804 2:58503100-58503122 CACAGTGCTCAGAAAAGAGCTGG + Intergenic
931760922 2:65416364-65416386 CACACTGCCCAGGGACGGGATGG + Intronic
931874761 2:66499664-66499686 CACACAGACCAGTGAAGTGAGGG + Intronic
932515291 2:72340930-72340952 CCTACTGGTCAGAGAAGGGACGG + Intronic
933726203 2:85429168-85429190 GACACTGATCAGAGAGCTGAAGG + Intronic
934943979 2:98523035-98523057 CACACTGAGCAGAGAAGTCATGG + Intronic
934970503 2:98760065-98760087 CACAAATCTCAGAGAAGTCATGG + Intergenic
935085615 2:99841721-99841743 GCCATGGCTCAGAGAAGTGAAGG + Intronic
936538430 2:113330247-113330269 GACAGGGCTCAGAGAAGTGCAGG + Intergenic
937601930 2:123747697-123747719 AACAAAGCTCAGAGAAGTAAAGG + Intergenic
937903010 2:127036890-127036912 AACCCTGCCCAGAGAATTGAAGG - Intergenic
938946214 2:136214298-136214320 CAGGCTGCTCAGAGAAGTCAGGG + Intergenic
942603909 2:177670403-177670425 CACACTATCCTGAGAAGTGAAGG - Intronic
942843143 2:180388919-180388941 AACACTGCTCAAAGAAATCAGGG - Intergenic
944627690 2:201589082-201589104 ACCACTGCTCAAAGAAGTCAGGG + Intronic
944898108 2:204186584-204186606 CTCTTTGCTCAGAGAGGTGAAGG - Intergenic
946239508 2:218345106-218345128 CACACTGCTCAGGGGAGGGGAGG + Exonic
947665212 2:231901103-231901125 CACACTGCACAGTGACGTGGGGG - Intergenic
1169001059 20:2168386-2168408 CAGACAGCTCAGAGAGGTCAAGG - Intronic
1169228694 20:3872462-3872484 CACACTGGGCAGAGATGTGTTGG - Exonic
1171164271 20:22956876-22956898 CACTCTGCTTTGAAAAGTGAGGG + Intergenic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1173794401 20:45848951-45848973 CACACTGCTCAGAGAAGTGAAGG - Intronic
1174275790 20:49403156-49403178 CAAAAGGCTCAGAGAAGTTAAGG + Intronic
1174825668 20:53766203-53766225 CACAAGGCTTAGAGAAGTAAAGG + Intergenic
1174867555 20:54152043-54152065 CAACCTGCTCAGGGAGGTGAGGG + Intergenic
1177352745 21:19965345-19965367 CACAGATCTCAGAGATGTGAAGG - Intergenic
1178672580 21:34604830-34604852 CACAGTGCTCAGAACAGAGATGG + Intronic
1181314324 22:21961880-21961902 CACACTCCTCACAGGAGTGGTGG - Intronic
1183587428 22:38760972-38760994 AACACTGCTGTGAGAACTGAAGG - Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184388070 22:44187549-44187571 CACACTGCTCAGGTTTGTGATGG + Intronic
1184445812 22:44546169-44546191 CTCAACGCTCAGAGAAGTGAGGG - Intergenic
949571945 3:5301968-5301990 CACATTGCCCAGAGACGTCAGGG - Intergenic
951233494 3:20207356-20207378 AACACTGCTCAAAGAAATCATGG - Intergenic
952863040 3:37830714-37830736 CACACTGCTGAGTGAGGTGCTGG - Intergenic
953284761 3:41595893-41595915 GACACTGATCAGAGAAATGAAGG + Intronic
954095737 3:48326224-48326246 CACACTGCGCTGGGAAGGGAAGG + Intronic
954958085 3:54539623-54539645 GACAGTGCTCACAGAAGTGAAGG + Intronic
956919672 3:73913770-73913792 CACACTTAACAGAGAAGTGCAGG + Intergenic
958027715 3:88068349-88068371 AACATAGCACAGAGAAGTGAAGG + Intronic
958843024 3:99231709-99231731 AACACTGCTCAAAGAAATCACGG + Intergenic
959800352 3:110486972-110486994 CACTCATTTCAGAGAAGTGAAGG + Intergenic
962462098 3:135623733-135623755 CACACTGATCACAGGAGTGCAGG + Intergenic
964202495 3:154133863-154133885 AACACTGCTCAAAGAAATCAGGG - Intronic
964949715 3:162275193-162275215 AACACTGCTAAAAGAAGTCATGG - Intergenic
965196556 3:165604658-165604680 AACACTGCTGAAAGAAGTCAGGG - Intergenic
965666989 3:171105637-171105659 CACACTGGACAGAGATGAGAGGG - Intronic
967314013 3:188133662-188133684 CAAACTGCTCAGAGGATTTAAGG - Intergenic
968179075 3:196577540-196577562 CCCATTGCTCAGAGCACTGATGG + Exonic
969451830 4:7278252-7278274 CAGGCTGCTCAGAGGAGAGAGGG - Intronic
969828242 4:9775230-9775252 CACCATGCTGTGAGAAGTGAGGG - Intronic
970296155 4:14632934-14632956 AACACTGCTCAAAGAAATCACGG + Intergenic
971312637 4:25538634-25538656 GACACTCCTCAGATAAGTGCAGG - Intergenic
975519539 4:75285297-75285319 CAAAGTGCTCTGAAAAGTGAAGG - Intergenic
976186275 4:82445940-82445962 CACTCTTCTCAGAGAACTCAAGG - Intronic
978323365 4:107522992-107523014 GAAGCTGCTCAGTGAAGTGAGGG + Intergenic
978942412 4:114452502-114452524 AACACTGCTCAAAGAAATCAGGG + Intergenic
979398446 4:120218297-120218319 AACACTGCTCAAAGAAATCAAGG - Intergenic
981943917 4:150318357-150318379 GACACTACTCAAAGAACTGAGGG + Intronic
982097881 4:151939760-151939782 CAAACTGCAAAGAGAAATGAGGG - Intergenic
982839860 4:160170524-160170546 CAGTCTGCTCAGAGGAATGAGGG - Intergenic
983372291 4:166876134-166876156 AAATCTCCTCAGAGAAGTGAGGG + Intronic
984371489 4:178872170-178872192 CACCCTCCTCAGTGAAGTGCTGG - Intergenic
985200213 4:187476768-187476790 CAAACTGGTCTGAGACGTGAGGG + Intergenic
986558575 5:9037976-9037998 CCCACTGCCCAAAGAAGTAAGGG + Exonic
992058688 5:73020036-73020058 CATACTTCTCAGAGAAGTGTTGG + Intronic
992564506 5:77984735-77984757 CACACTTTTCAGAGAGGAGACGG + Intergenic
992743847 5:79799779-79799801 CACACTGCTCTGTAAAGTCAAGG - Exonic
995443974 5:112222586-112222608 CACACAGCTTTGAGAAGAGAGGG - Intronic
996778092 5:127154883-127154905 AACACTGCTCAAAGAAATCAGGG - Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
997405416 5:133642423-133642445 CAGACAGCTCACAGAAGTGTTGG - Intergenic
997416995 5:133736647-133736669 CACAGTGGAGAGAGAAGTGAGGG + Intergenic
997887372 5:137642304-137642326 CAGAGTGCTCAGAGATGGGAAGG - Intronic
998494700 5:142577876-142577898 CACTCTAGTCAGAGAAGGGATGG - Intergenic
1001037519 5:168308217-168308239 CACAGTTCTCAAAGAAGGGATGG - Intronic
1001310780 5:170608807-170608829 CCCTTTGCTCAGAGAAATGATGG + Intronic
1003263131 6:4541485-4541507 AACACTGCTAAGAGAAATTAAGG + Intergenic
1003790069 6:9536227-9536249 CACACTGCACAGAAAGATGATGG - Intergenic
1004039514 6:11961772-11961794 CAAACTGCTGAGAGAAGAGGTGG + Intergenic
1004214008 6:13684622-13684644 TTCATTGATCAGAGAAGTGAAGG - Intronic
1005160369 6:22853452-22853474 CACACTGCAGAGAACAGTGATGG - Intergenic
1006884908 6:37373249-37373271 CAGACTGCTTAGGGCAGTGAAGG - Intronic
1008764645 6:54896526-54896548 CACACTGATAAGAGAAGGAAGGG + Intronic
1009252908 6:61330580-61330602 CACACAACACAAAGAAGTGATGG - Intergenic
1009257594 6:61432401-61432423 CACACAACACAAAGAAGTGATGG - Intergenic
1009330538 6:62414159-62414181 AACACTGCTCAAAGAAATTAGGG + Intergenic
1011724796 6:90199201-90199223 CACACTGCTCTGAGATTTGGTGG + Intronic
1011984223 6:93421617-93421639 TACACTCATCAGAGGAGTGAAGG - Intergenic
1012360906 6:98378477-98378499 AACACTGCTCAGAGAAATCAGGG - Intergenic
1012394016 6:98774980-98775002 CACAGTGCAGAGAAAAGTGAAGG + Intergenic
1012657975 6:101849650-101849672 CACACTGCTCAGAAAATAGAAGG + Intronic
1013538388 6:111084448-111084470 CACCATGCTCAGCGCAGTGATGG - Intergenic
1016453246 6:144205395-144205417 AACACTGCTCAAAGAAATCAGGG - Intergenic
1017625900 6:156348490-156348512 CACACTGATCTGAGAAATCAAGG + Intergenic
1018076196 6:160215799-160215821 CACACTGGCCAGAGATGGGAAGG - Intronic
1018612178 6:165656863-165656885 CACACAGATCACAGAAGAGATGG - Intronic
1018890937 6:167981298-167981320 CACTGTGCTCATAGAAGTGAGGG + Intergenic
1019132705 6:169889040-169889062 TACAAGGCTCAGAGCAGTGAAGG - Intergenic
1021392689 7:20113491-20113513 GACACTGCTCTCAGAAGAGATGG - Intergenic
1023486885 7:40697299-40697321 CACAGTGCCCAGTGAAATGAAGG + Intronic
1024222807 7:47301771-47301793 CACCCTCCTCTGAGAAGTCAGGG - Intronic
1024602274 7:50994357-50994379 CACAGTACACTGAGAAGTGAGGG - Intergenic
1024825607 7:53386431-53386453 CACCCTAATCAGAGCAGTGAAGG - Intergenic
1024974225 7:55098382-55098404 GGAACTGCTCAGAGACGTGATGG + Intronic
1026449243 7:70512871-70512893 CACACTGGTGAGTGAAGTGTGGG + Intronic
1031216612 7:118900647-118900669 TACATTGTTCAGAGAAGTGCTGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032965494 7:137092738-137092760 CACACTGCTGAGAGATATTAGGG - Intergenic
1033000860 7:137502857-137502879 CACTGAGCTCAGAGAAGTGAAGG + Intronic
1033181105 7:139179433-139179455 CAGGCTGCTAAGAAAAGTGAGGG - Intronic
1033592128 7:142818070-142818092 GACACAGCTCAGAGAAGAGGAGG + Intergenic
1034107317 7:148501542-148501564 GACACGGCTCAGATAAGTGGAGG + Intergenic
1035022345 7:155807086-155807108 CGCACTGCTTGGAGAATTGAAGG + Intronic
1036805379 8:11828423-11828445 CACAGGGCTCAGAGAAGGGAAGG + Intronic
1038134307 8:24769104-24769126 CACAGTGCTGAGAGAACAGAAGG + Intergenic
1038953913 8:32446850-32446872 CACACTCCTGAGAGAAGTTTAGG + Intronic
1039011119 8:33093978-33094000 AACACTGCTGAGAGAAATGATGG + Intergenic
1039272665 8:35899841-35899863 GACACTGATCAGAGATGGGATGG + Intergenic
1039782272 8:40797245-40797267 CACACTGCTCAGACAGGTGCTGG - Intronic
1040670474 8:49684185-49684207 CACAGTGCTTGGAGAAGAGAAGG - Intergenic
1040787860 8:51187967-51187989 CAGGCTGCACAGAGAAGTGGTGG - Intergenic
1041295198 8:56349764-56349786 AACACTGCTGAGAGAAATCAGGG - Intergenic
1042224384 8:66504143-66504165 CCCACTGTGCAGAGAAGAGATGG + Intronic
1042452040 8:68958648-68958670 AACACTGCTCAAAGAAATCAGGG + Intergenic
1042504817 8:69548937-69548959 CACACAAACCAGAGAAGTGAAGG + Intronic
1045578266 8:103449209-103449231 CACACTGCTGAGAGTACTGCAGG + Intergenic
1045693920 8:104786763-104786785 CACTCTGCTCAAAACAGTGATGG + Intronic
1048011214 8:130457843-130457865 CATCCTGCTCAGGCAAGTGAGGG - Intergenic
1048314176 8:133350018-133350040 GGCAATGCCCAGAGAAGTGAAGG + Intergenic
1048923549 8:139251526-139251548 CACCTTGCTCTGAGAAGGGAGGG - Intergenic
1050841490 9:10155110-10155132 AACACTGCTCAAAGAAATCAGGG - Intronic
1052007438 9:23365727-23365749 AACATTGCTGAGAGAAATGAAGG + Intergenic
1052288031 9:26809252-26809274 CACACTGTTAAAAGAAATGAGGG + Intergenic
1052780010 9:32772121-32772143 AACACTGCTCAGAGAAATCAGGG - Intergenic
1053297268 9:36923796-36923818 CACACTCCTCAGTGCAGGGATGG + Intronic
1054938370 9:70713343-70713365 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054940061 9:70731336-70731358 CTCACTGACCAGAGAAGGGAAGG - Intronic
1055470180 9:76603058-76603080 CCCAGTGCTCAGAGGAGAGATGG - Intergenic
1055934223 9:81589987-81590009 CATGCTGCACAGAGAAGGGACGG - Intronic
1056912716 9:90718022-90718044 CACACTGCTCACAGAAGTCCAGG + Intergenic
1056970229 9:91195379-91195401 CACTCTGCTCAGAGATGTTTGGG - Intergenic
1058214032 9:102210368-102210390 CAAACTTCTGATAGAAGTGATGG - Intergenic
1058425047 9:104868944-104868966 CTCTATGCTCAGAGAACTGAAGG - Intronic
1060038474 9:120279571-120279593 CAGGATGTTCAGAGAAGTGATGG + Intergenic
1060528799 9:124335545-124335567 CACACTGCTCATTTAACTGATGG - Intronic
1060728551 9:126022418-126022440 GAAACAGCTCAGAGAAGTGAAGG + Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1188065598 X:25655825-25655847 CACATTGCACAGAGGAGTGTGGG + Intergenic
1188470796 X:30537061-30537083 AACACTGCTCAAAGAAATCATGG + Intergenic
1188983257 X:36747370-36747392 AACACTGCTCAAAGAAATCAGGG - Intergenic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1191039122 X:56060017-56060039 CTCACTGCTCAAGGAAGTAAGGG - Intergenic
1191883461 X:65864801-65864823 CAAAATCCTCAGAGAAGTTAGGG - Intergenic
1192074911 X:67983709-67983731 CAAACAGCTCAGAGAACTGCTGG + Intergenic
1193046934 X:77063837-77063859 CACACAGCTGGGAGAAGGGAGGG - Intergenic
1195322829 X:103734484-103734506 CACACTGCTGTGGAAAGTGAGGG - Intergenic
1195768922 X:108327879-108327901 CCCACTGCCCAAATAAGTGATGG + Intronic
1196518474 X:116642268-116642290 AACAGTGCTCAGAGAAGTGGAGG + Intergenic
1197931196 X:131698018-131698040 CACTCTGCTCACAGAAATGTAGG - Intergenic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic