ID: 1173798095

View in Genome Browser
Species Human (GRCh38)
Location 20:45876649-45876671
Sequence TCTTATCTTTATAAGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173798080_1173798095 29 Left 1173798080 20:45876597-45876619 CCAAAGTGCTGGGGTTATAGGCA 0: 206
1: 12486
2: 117102
3: 246504
4: 241017
Right 1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1173798081_1173798095 2 Left 1173798081 20:45876624-45876646 CCACTGTACCCAGCCCCCTTCAG 0: 1
1: 1
2: 21
3: 234
4: 1492
Right 1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1173798084_1173798095 -6 Left 1173798084 20:45876632-45876654 CCCAGCCCCCTTCAGGGTCTTAT 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1173798085_1173798095 -7 Left 1173798085 20:45876633-45876655 CCAGCCCCCTTCAGGGTCTTATC 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1173798079_1173798095 30 Left 1173798079 20:45876596-45876618 CCCAAAGTGCTGGGGTTATAGGC 0: 329
1: 23969
2: 251186
3: 272230
4: 172405
Right 1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173798095 Original CRISPR TCTTATCTTTATAAGGGGTG GGG Intronic
902259903 1:15217011-15217033 TCTTATCTTTATAGTGGGAAGGG + Intronic
903579893 1:24362926-24362948 GCTTTTATTTATAAGGGGAGAGG - Intronic
912802657 1:112730197-112730219 TCTTCTCTGTAGCAGGGGTGAGG - Intergenic
912983020 1:114395873-114395895 TCTTTTCTTAACAAGGGGTGGGG - Exonic
913520521 1:119641232-119641254 GCTTATTGTTATAAGGGGGGTGG + Intronic
914869984 1:151465042-151465064 TCTTATGTTTAGAAGAGTTGGGG + Intergenic
915399723 1:155613330-155613352 TTTTTCCTTTTTAAGGGGTGGGG - Intronic
917979947 1:180263018-180263040 GCTTATCTTTCTGAAGGGTGAGG + Intronic
920785123 1:209033943-209033965 TCTTATCTTTTAAAGGTGTGTGG - Intergenic
921828638 1:219702180-219702202 TCTTCTCTTTATATGTGGAGAGG + Intronic
923516623 1:234703211-234703233 TCTTATTTTTAGTAGAGGTGGGG + Intergenic
1064914791 10:20444842-20444864 TCATATCTTTATTAGAGATGGGG - Intergenic
1068962499 10:62879851-62879873 TCTTTTCTTTTTAAGAGATGGGG - Intronic
1070929914 10:80253767-80253789 TTTTTTCATTTTAAGGGGTGGGG + Intergenic
1073357089 10:102865245-102865267 TTTTATCTTTATAAGGAGCTGGG - Intronic
1074113188 10:110437087-110437109 TATTTTCTTTATAAGAGATGGGG + Intergenic
1074958427 10:118415742-118415764 TCTGTTGCTTATAAGGGGTGGGG + Intergenic
1078755115 11:14201568-14201590 TCTTATTTTTAGAAGAGATGAGG + Intronic
1079197107 11:18338615-18338637 TCTTATTTTTATAGGGCGGGGGG + Intronic
1086541627 11:87919023-87919045 TTTGATTTTTATAAGTGGTGAGG + Intergenic
1087802139 11:102516026-102516048 TCTCATTTAAATAAGGGGTGTGG + Intergenic
1088476864 11:110249695-110249717 TCTTATTTTTAGAAGAGATGAGG - Intronic
1088603905 11:111511112-111511134 TCTTATCTTTGTGAGGGGCACGG - Intronic
1093844816 12:23956683-23956705 TCTTTTTTTTTTAAGGGGAGGGG + Intergenic
1093863016 12:24191000-24191022 TCTTCTTTTTTTAAGAGGTGGGG + Intergenic
1097152339 12:56988142-56988164 TCTCATCTTTATAACGAGGGAGG + Intergenic
1098346689 12:69512526-69512548 TGGTATCTTTATAAGGTGAGTGG + Intronic
1100619019 12:96254150-96254172 TCTTATCTTTAGTAGAGATGGGG - Intronic
1100624148 12:96312747-96312769 TCTTTTCTTTGTAAGTGTTGTGG - Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1101891129 12:108716357-108716379 TCATATCTTAAAAAGGGATGGGG + Intronic
1102937793 12:116911939-116911961 TCTTATCTTTTTGTGGGGCGTGG + Intronic
1105424727 13:20284543-20284565 TCTTATCTACATAAGGGAAGAGG + Intergenic
1106273551 13:28179540-28179562 TTTTATTTTTATAAGAGATGGGG - Intronic
1106854372 13:33832706-33832728 TTTTATCTCTTTAAAGGGTGAGG - Intronic
1107250260 13:38351112-38351134 TCTTAACTATATAAGGAGTAAGG - Intronic
1109566757 13:64128007-64128029 TCTTATCTGTAAAAAGGATGTGG + Intergenic
1110382670 13:74872365-74872387 ACTTATCTTTTTGAGGGATGAGG + Intergenic
1113232858 13:108235047-108235069 TCCTATCTTACTAAGGGGAGAGG + Intergenic
1116371407 14:44137832-44137854 TCTTTTCTTTTTTAGGGGTTGGG - Intergenic
1117239688 14:53817371-53817393 TCTCATCTTTATAAGCAGTATGG + Intergenic
1117674103 14:58138590-58138612 GCTTCTCCTTATCAGGGGTGAGG + Exonic
1117784965 14:59273719-59273741 TTTGATCTTTATAAGTAGTGTGG + Intronic
1121196149 14:92074152-92074174 TCTTATTTTTAGTAGAGGTGGGG - Intronic
1121859372 14:97302203-97302225 TCTTATCTTTAAAATGAGAGAGG + Intergenic
1127611086 15:60637979-60638001 TCTTGTGTCTATAAAGGGTGGGG + Intronic
1129906104 15:79188366-79188388 TCTTATTTTTTTAAGAGATGTGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131437718 15:92436343-92436365 TCTCGTCTTCACAAGGGGTGGGG - Intronic
1131647219 15:94358353-94358375 GTTTACCTTTATAAGGGGTGAGG + Intronic
1132002046 15:98190352-98190374 TCTTTTCTTTTTGAGGGGTGAGG - Intergenic
1133897266 16:9941710-9941732 TCTCATCTATAAAATGGGTGTGG + Intronic
1134667994 16:16033516-16033538 TATTATTTTTCTAAGGCGTGGGG - Intronic
1135858749 16:26035953-26035975 TGTTATCTGCATAAGAGGTGTGG + Intronic
1144011977 17:11157721-11157743 TATTATTTTTTTAAGAGGTGAGG - Intergenic
1144222066 17:13108493-13108515 TATTATTTTTATAAGAGATGAGG + Intergenic
1146440080 17:32886179-32886201 TCTCATCTTTATTAAAGGTGAGG - Intergenic
1147166641 17:38596886-38596908 TCTAACCTTTCTAAAGGGTGGGG - Intronic
1148633193 17:49128048-49128070 TCTTTTTTTTATCAGGGGTGAGG + Intergenic
1149309113 17:55377047-55377069 TCTTATTTTTTTTAGGGATGGGG - Intergenic
1151306572 17:73266512-73266534 GCTCATCTGTAAAAGGGGTGAGG - Intergenic
1151394870 17:73816173-73816195 TCTTTTCTTTTTTAGGGATGGGG + Intergenic
1156248478 18:35327047-35327069 TCTTACCTTACTATGGGGTGAGG - Intergenic
1156311225 18:35923945-35923967 TCCTATCTATCTAAGGGGTCTGG - Intergenic
1160317308 18:77859665-77859687 TTTTATCTTTATAGGGGGAGAGG + Intergenic
1163110861 19:15160463-15160485 TCCTTTATTTATAATGGGTGGGG - Exonic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164644511 19:29848493-29848515 TCAGGGCTTTATAAGGGGTGGGG - Intergenic
1167688867 19:50973164-50973186 TCTTATCTGTAAAATGGGAGTGG - Intergenic
926164331 2:10509907-10509929 TAATTTCTTTATAAGGTGTGAGG - Intergenic
926215753 2:10904205-10904227 TCTTATTTAAATAAAGGGTGGGG - Intergenic
926829928 2:16950583-16950605 TCTTATCTTTACAAGTTGTTTGG - Intergenic
927372665 2:22375010-22375032 TCTTACCTTTAGAAGGGTTTAGG - Intergenic
930158478 2:48129108-48129130 ACTTATCTTGTTAACGGGTGTGG - Intergenic
930713335 2:54569974-54569996 TCTAATCTTTCTAAAGGGGGGGG - Intronic
930774352 2:55157935-55157957 TCTTTTGTTTATGAGAGGTGTGG - Intergenic
931716159 2:65030291-65030313 TTTTATCTTTAGTAGAGGTGGGG - Intergenic
931780126 2:65572297-65572319 TGGTATCTTTATAAGAAGTGGGG + Intergenic
935726723 2:106030107-106030129 TCATATCTTGATCAGGGTTGTGG - Intergenic
938089997 2:128425186-128425208 TCCTGTCTTTGTGAGGGGTGCGG + Intergenic
940007305 2:149019871-149019893 ACCTTTCTTTAGAAGGGGTGGGG - Intronic
940686609 2:156858579-156858601 TCATATTTTTAGTAGGGGTGGGG + Intergenic
940866131 2:158819447-158819469 TCTTATCATTCTAAAGGGGGTGG - Intronic
941290948 2:163673893-163673915 TCATATCATTTTAAGAGGTGAGG - Intronic
941291531 2:163681536-163681558 TTTTATCTTTTTAAGAGATGGGG - Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
941864673 2:170322320-170322342 TCTTCTCTTTAAAAGGGCTTTGG - Intronic
942633976 2:177981677-177981699 ACTTATCTTTTGCAGGGGTGTGG + Intronic
946349120 2:219136773-219136795 TCTTATCTTTAGTAGAGATGGGG + Intronic
947397827 2:229703704-229703726 TCTTATTTTTAATAGAGGTGGGG - Intronic
1171848113 20:30290148-30290170 TCTTATTTTTATAAGAGGGCCGG - Intergenic
1172016409 20:31877043-31877065 TCTTTTCTTTTGTAGGGGTGAGG + Intronic
1172206328 20:33165404-33165426 TGTTATCTGGAGAAGGGGTGGGG + Intronic
1172570727 20:35968301-35968323 TCTTATGTTAATGAGGGATGGGG + Intronic
1173547959 20:43914147-43914169 CCCTATCATTAAAAGGGGTGGGG + Intergenic
1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG + Intronic
1173961428 20:47075376-47075398 TCTTATCTAGAAAAAGGGTGGGG - Intronic
1178041712 21:28646966-28646988 CCTGTTCTTAATAAGGGGTGTGG + Intergenic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1179483679 21:41694802-41694824 TATTATTTTTATAATGGGAGTGG + Intergenic
1180915987 22:19487521-19487543 TCTTTTCTTTTTAAGAGATGAGG - Intronic
1183756906 22:39775895-39775917 TTTTTTCTTTTTAAGGGGTTGGG + Intronic
950397235 3:12742871-12742893 CCTTATCTGTATAATGGGTGGGG - Intronic
953621052 3:44533172-44533194 TAGTATGTTTCTAAGGGGTGTGG - Intergenic
953783746 3:45894999-45895021 TCTTCCCTTTTTAGGGGGTGTGG + Intronic
954333968 3:49905532-49905554 TCTTCTGTTTATGAGGAGTGGGG + Intronic
954808246 3:53232548-53232570 TCCCATCTTTAAAATGGGTGAGG + Intronic
956308297 3:67850600-67850622 TCTTGAATTTAAAAGGGGTGAGG + Intergenic
956351031 3:68336894-68336916 TCTTATTTTTAGAAGAGATGGGG + Intronic
957220995 3:77381879-77381901 TCTGATGTTTATGGGGGGTGAGG + Intronic
958565738 3:95807400-95807422 TCCTATCTTTGTAAGGCGAGAGG - Intergenic
959308333 3:104697133-104697155 TCTTATTTTTAAGAGGGGTGAGG + Intergenic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
963717880 3:148824696-148824718 TTTTTTCTTTAAAAGGAGTGAGG + Intronic
965170650 3:165259118-165259140 TCTTATTTTTTTAAGAGATGGGG + Intergenic
965783588 3:172313747-172313769 TTTCATCTTTATAAGGGGATGGG - Intronic
966306270 3:178538781-178538803 TTTTTTCTTTATAAGCTGTGAGG + Intronic
967061843 3:185879666-185879688 TTTTATTTTTAGTAGGGGTGGGG - Intergenic
969241909 4:5904528-5904550 CCTTATCTGTAAAATGGGTGTGG - Intronic
970073905 4:12195901-12195923 ACTTATATTTAAAAGGGGAGGGG - Intergenic
970238165 4:13980002-13980024 TCTTATTTTTTTAGGGGGGGGGG - Intergenic
970380552 4:15503122-15503144 TTTTATTTTTAGTAGGGGTGGGG - Intronic
973637101 4:52870493-52870515 AATTATGTTTATAAGGAGTGTGG + Intergenic
974218537 4:58933092-58933114 TTTTATTTTTTTAAGTGGTGAGG - Intergenic
975977427 4:80115481-80115503 TCTTATCTTTTGAAGTGCTGTGG - Intronic
978619449 4:110623512-110623534 TCTCCTTTTTATATGGGGTGGGG - Intronic
979267043 4:118715879-118715901 TGTTAGCTTTATAAGGGCAGTGG + Intergenic
979876882 4:125903507-125903529 TCTTATCTGCAGTAGGGGTGTGG + Intergenic
980142739 4:128940158-128940180 TCTTTTTTTTATAATGAGTGGGG - Intronic
981723959 4:147828855-147828877 TCTTGACTTTTTAAAGGGTGAGG - Intronic
982049050 4:151481094-151481116 TCCTATCTTTAGATGGGTTGAGG - Intronic
982631861 4:157840269-157840291 TCTTTTATTTATAAGCTGTGTGG + Intergenic
983077395 4:163343502-163343524 TTTTATCTTTGTTTGGGGTGGGG - Intronic
984481035 4:180302359-180302381 TCTTTTCTTTTTTAGAGGTGGGG - Intergenic
987389188 5:17360222-17360244 TCTTTTCTTTACAAAGGGTAAGG - Intergenic
987657956 5:20832658-20832680 TCTTAGCTTAGTATGGGGTGTGG + Intergenic
990512279 5:56499649-56499671 TCTCAACTTTGTGAGGGGTGGGG - Intergenic
990746361 5:58963187-58963209 TCTTTTCTTTGTAAGAGTTGGGG + Intergenic
991298597 5:65105773-65105795 TCTTATCTCTCCAAGGGGAGAGG + Intergenic
991486402 5:67141384-67141406 TTTTCTCTTTATATGGGGTATGG + Intronic
991531369 5:67618870-67618892 TCTAATCTTGATCAGGGATGAGG + Intergenic
992554755 5:77892351-77892373 CTTTATCTTTACAGGGGGTGGGG + Intergenic
995171061 5:109112680-109112702 TCTTGTCTTTATGAGGAGAGAGG + Intronic
995744799 5:115392434-115392456 CCTTATCTTTAAAAGGGAGGAGG - Intergenic
996764765 5:127024751-127024773 TCTTACCTTTGGCAGGGGTGGGG + Intronic
997071739 5:130630429-130630451 TCTTATTTTTATTAGAGATGGGG - Intergenic
997810161 5:136959368-136959390 TCTTTTCTTTATGGGGGGTGGGG + Intergenic
999768781 5:154758991-154759013 TCTTATACTTAAAAGGGGTATGG - Intronic
999875974 5:155806151-155806173 TCTTTTCTTTTTTGGGGGTGTGG + Intergenic
1003743664 6:8973705-8973727 TCTTATATTAATAAGGAATGGGG + Intergenic
1004215608 6:13701461-13701483 TGTTTTCTTGATAAGAGGTGAGG - Intronic
1004410564 6:15377704-15377726 TTTTATCTTTAGTAGGGATGGGG + Intronic
1006016130 6:31082444-31082466 TGAAATCTTTATAAGGGCTGAGG - Intergenic
1006063382 6:31442327-31442349 CTTTTTCTTTATAAGGGGGGGGG + Intergenic
1010031764 6:71278546-71278568 TCCCATCTTAACAAGGGGTGTGG - Intergenic
1010250645 6:73703749-73703771 TTTGTTCTGTATAAGGGGTGGGG + Intronic
1010639874 6:78311471-78311493 TCTGATTTTTAAAAGTGGTGAGG - Intergenic
1012154775 6:95804776-95804798 TCTTCTCTTTATATGGCCTGAGG - Intergenic
1013545588 6:111153810-111153832 TCTTATCTTTGTAAGGAGAAAGG - Intronic
1016391782 6:143581836-143581858 TCTTTCCTTTTTGAGGGGTGGGG - Intronic
1016474126 6:144407649-144407671 TCTTTTCTTGATAAGGGATTTGG + Intronic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1019902680 7:4035155-4035177 TCTTATCTTTAGTAGAGATGGGG + Intronic
1020174537 7:5871740-5871762 TCTTTTTTTTTTTAGGGGTGGGG + Intergenic
1021076885 7:16315925-16315947 TCATATCTTTCAGAGGGGTGAGG - Intronic
1021920163 7:25476674-25476696 TCTTATTATTATAAGGGCTTTGG + Intergenic
1023444388 7:40216677-40216699 TTGTATTTTTATAAGAGGTGGGG - Intronic
1026415617 7:70177756-70177778 ACAAATCTTTGTAAGGGGTGGGG - Intronic
1027603858 7:80275025-80275047 TCTAATTTTTAAAAGGGGGGAGG - Intergenic
1030147494 7:106371413-106371435 GCTTATCTTTTTGTGGGGTGGGG - Intergenic
1030233688 7:107235310-107235332 ATTTATCTTTATAAGTGGGGAGG + Intronic
1032321732 7:130891918-130891940 TCTTAACTTTATAACCTGTGTGG - Intergenic
1034352300 7:150424726-150424748 TCTTTTCTTTTTAAGGATTGTGG + Intergenic
1036198343 8:6743694-6743716 TCTAATGGTTATAAGGGATGTGG + Intronic
1038375890 8:27039848-27039870 TCTTAGCGTTATATGGGGAGAGG - Intergenic
1039794492 8:40900858-40900880 TCTTATTTTCTTAAGGGGGGTGG - Intergenic
1043049521 8:75367293-75367315 TTTTCTCTTTTTAGGGGGTGGGG - Intergenic
1043202903 8:77393787-77393809 TCTTATTTTTATAAGAACTGTGG + Intergenic
1044962945 8:97548729-97548751 TCTTATATTTTTAAGGGAAGGGG + Intergenic
1045259918 8:100563479-100563501 TCGTATCTTTAGTAGGGATGGGG - Intergenic
1046353869 8:113052765-113052787 TATTATCTTTTTAAGAGATGGGG - Intronic
1046912365 8:119642836-119642858 TCTTATCTTCATCAGGGCTAGGG - Intronic
1047355189 8:124114222-124114244 TCCTATCTTTTTGGGGGGTGGGG - Intronic
1047556957 8:125942071-125942093 TCTTAGCTTTACTTGGGGTGGGG + Intergenic
1048180125 8:132186882-132186904 TGTTATCTTTATAAACTGTGAGG + Intronic
1048460752 8:134619800-134619822 CCTTATCTTTATAAGGGGCTTGG - Intronic
1049699437 8:144002622-144002644 TTTCATCTTTAAAATGGGTGTGG - Intronic
1050364282 9:4859789-4859811 TCTTTTTTTTATAAGAGATGGGG - Intronic
1051157234 9:14162912-14162934 TCTTATCTTTTTAATGGATGTGG + Intronic
1051213231 9:14767780-14767802 TATTTTCTTTATAAGCGATGGGG - Intronic
1053380708 9:37648027-37648049 TCTAATCATTATATGCGGTGAGG - Intronic
1053786247 9:41654800-41654822 TCTTATTTTTATAAGAGGCCCGG - Intergenic
1054158805 9:61659399-61659421 TCTTATTTTTATAAGAGGTCCGG + Intergenic
1054174959 9:61868744-61868766 TCTTATTTTTATAAGAGGCCCGG - Intergenic
1054449820 9:65397788-65397810 TCTTATTTTTATAAGAGGGCCGG - Intergenic
1054478579 9:65590404-65590426 TCTTATTTTTATAAGAGGTCCGG + Intergenic
1054662578 9:67712049-67712071 TCTTATTTTTATAAGAGGCCCGG + Intergenic
1055163304 9:73158439-73158461 TCTTATGTATGTAAGAGGTGAGG + Exonic
1055349226 9:75368496-75368518 TCTCATCTTTAAAAAGGGAGAGG + Intergenic
1056686859 9:88773407-88773429 TATTATCTTTTTAATGGCTGTGG - Intergenic
1057687599 9:97249485-97249507 TTTTATCTTTATTAGAGATGGGG + Intergenic
1057781194 9:98051880-98051902 TCTCATATTTAGCAGGGGTGAGG + Intergenic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1062559046 9:137131081-137131103 TCTTAACGTTAGAAGAGGTGAGG + Intergenic
1186606895 X:11101730-11101752 TTTTAAATTTAAAAGGGGTGTGG - Intergenic
1187232790 X:17438456-17438478 TCTCATCTTTAAAGGAGGTGGGG + Intronic
1187720444 X:22145260-22145282 TCTGATCTTCATATGGGGTGTGG - Intronic
1188092380 X:25978806-25978828 TTTGATCTTTATAATTGGTGTGG - Intergenic
1188507773 X:30901544-30901566 TCTTAGCTGAATAAGGAGTGAGG + Intronic
1195951461 X:110278615-110278637 TCTTATCTTCCTAGGGAGTGTGG - Intronic
1199855077 X:151753258-151753280 TGTTATCTATATAACGGGTAAGG + Intergenic
1201509487 Y:14743186-14743208 TCATGTTTTTAAAAGGGGTGAGG + Intronic
1202306235 Y:23473868-23473890 TCATATCATAAAAAGGGGTGGGG + Intergenic
1202564574 Y:26196721-26196743 TCATATCATAAAAAGGGGTGGGG - Intergenic