ID: 1173801204

View in Genome Browser
Species Human (GRCh38)
Location 20:45895612-45895634
Sequence ATGTGGCTACGTAATGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173801204_1173801208 19 Left 1173801204 20:45895612-45895634 CCCATTTCATTACGTAGCCACAT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1173801208 20:45895654-45895676 CACTACAGCCTCAACCTCCTAGG 0: 250
1: 5191
2: 21099
3: 66104
4: 169222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173801204 Original CRISPR ATGTGGCTACGTAATGAAAT GGG (reversed) Intronic
917562822 1:176177674-176177696 ATTTGGATACGTAATAAAAGAGG - Intronic
919435747 1:197557976-197557998 ATGTGTTTACTAAATGAAATAGG - Intronic
921166578 1:212512374-212512396 AGGTGGCTAGGCAGTGAAATGGG - Intergenic
921842032 1:219838926-219838948 ATGTGGCTATGTTAAAAAATGGG - Intronic
923736389 1:236612165-236612187 ATGTGGCTAGGTCTTGAAAATGG - Intergenic
924074505 1:240319291-240319313 ATTTAGCTACATTATGAAATTGG + Intronic
1063179158 10:3581833-3581855 AGGTTGCCAGGTAATGAAATCGG + Intergenic
1067332753 10:45337241-45337263 ATGTGGAAACATAATGAAGTTGG + Intergenic
1068434215 10:56970037-56970059 ATGTGGGTAAGTAAAGAAAGAGG - Intergenic
1069060168 10:63886882-63886904 ATGTGGTTACATAATCAAACTGG + Intergenic
1079568174 11:21908938-21908960 ATGTGGTAATTTAATGAAATGGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1098131997 12:67360853-67360875 ATGAGGGAATGTAATGAAATTGG + Intergenic
1098540977 12:71657466-71657488 ATATGGGCACGTAATGAAAGTGG - Intronic
1099990663 12:89717594-89717616 ATGAGGCTAAGGACTGAAATGGG + Intergenic
1101396167 12:104349924-104349946 ATTTGGCTGTGTAAAGAAATGGG + Exonic
1103641485 12:122356164-122356186 ATTTAGCTATATAATGAAATTGG - Intronic
1115053502 14:29093751-29093773 ATGTGGCTACATAATTAACATGG - Intergenic
1117481692 14:56152149-56152171 ATGTGGCCACGTAATGGTTTGGG - Intronic
1117924545 14:60764732-60764754 ATGTGTATACGTAAATAAATAGG + Intronic
1120017052 14:79485958-79485980 ATATGGCTATGTAATAAGATGGG + Intronic
1130750927 15:86712489-86712511 ATGTGGCTAAGTGATGCACTTGG + Intronic
1133861154 16:9596880-9596902 ATGTGGCTAGGGACTGAGATTGG - Intergenic
1134844093 16:17425228-17425250 ATCTGGCTACGGAAGGAAGTTGG - Intronic
1137279374 16:46962298-46962320 ATGTTGCTGCATAATTAAATTGG - Intronic
1156631924 18:38980363-38980385 GTGTGGCTCCATAAAGAAATAGG - Intergenic
1159194309 18:65092159-65092181 ATTTGGCTATATAATTAAATTGG - Intergenic
927483236 2:23470723-23470745 TTGTGGCTCCTTAATGGAATAGG + Intronic
929030574 2:37646710-37646732 AAGTGGCTTCGAAATGAGATGGG + Exonic
930305843 2:49673507-49673529 ATGTGGCTAAGTAATGGCAAAGG - Intergenic
930336331 2:50051874-50051896 ATGTGGCTACAAAATAAAATGGG - Intronic
930841380 2:55850625-55850647 TTGTGTCTACATAGTGAAATAGG - Intergenic
933077729 2:77950746-77950768 ATGTTGCTAAATAATGGAATTGG - Intergenic
940407216 2:153318814-153318836 ATATGGCTATGTAGTAAAATGGG + Intergenic
941016477 2:160363292-160363314 ATGTGGCTAAGTAATGTAACAGG + Intronic
941167984 2:162104025-162104047 ATGCTGCCACGTAATGAAAAGGG - Intergenic
942768501 2:179486396-179486418 ATGTGGGTATATAATTAAATAGG - Intronic
943508313 2:188791181-188791203 AATTGACTACGTTATGAAATAGG + Intergenic
943610228 2:190024103-190024125 ATGTGGAGAAGTAATGAGATGGG + Intronic
944126315 2:196297055-196297077 ATGAGACTATGTTATGAAATAGG - Intronic
944199758 2:197093915-197093937 ATGTGGCAATTTAACGAAATTGG - Intronic
1173801204 20:45895612-45895634 ATGTGGCTACGTAATGAAATGGG - Intronic
949691776 3:6648728-6648750 AGGTGGCCAGATAATGAAATAGG + Intergenic
957519348 3:81298716-81298738 ATGAAGCAACTTAATGAAATGGG + Intergenic
964148021 3:153489616-153489638 ATGTGACTACAAAATGTAATAGG - Intronic
966302895 3:178498523-178498545 AGATGGCTATGTATTGAAATGGG - Intronic
967158273 3:186713055-186713077 CTGGGGCTACGTAATGAAGGCGG + Intergenic
967341790 3:188406518-188406540 CTATGGTTACATAATGAAATAGG + Intronic
975068514 4:70100965-70100987 AAGTAACTACGTAATGAAAAAGG + Intergenic
975994083 4:80294256-80294278 ATGTGGCAACATAAATAAATGGG - Intronic
979221757 4:118234713-118234735 ATGTGGCTAGGTACTCTAATAGG + Intronic
983560328 4:169095037-169095059 GCGTGGCACCGTAATGAAATCGG + Exonic
989401585 5:41013535-41013557 ATCTGGCTACTTAATGCAAAGGG - Intronic
997481194 5:134185816-134185838 CTGAGGCTACTTAATGAAAATGG - Intronic
999076543 5:148801381-148801403 TTGAGGCTACATCATGAAATTGG - Intergenic
999621168 5:153475718-153475740 ACGTGGCTAGGTTTTGAAATGGG + Intergenic
999848083 5:155507277-155507299 ATGAGGCTATGTTATGAAATTGG + Intergenic
1001003016 5:168025573-168025595 ATGTGGCTACATTGGGAAATAGG + Intronic
1002062492 5:176634106-176634128 ATGTTGCTGCAAAATGAAATAGG + Intronic
1002609564 5:180406383-180406405 ATGTGTCTACATATTTAAATCGG - Intergenic
1004085423 6:12443159-12443181 ATCTGTCTACGTAATGGACTTGG - Intergenic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1027616279 7:80428467-80428489 ATGTTTCTAAGTAATAAAATAGG - Intronic
1029976392 7:104838690-104838712 ATGTGTCTATGGTATGAAATTGG - Intronic
1031863902 7:127015767-127015789 ATATGTCTCCCTAATGAAATAGG - Intronic
1038460210 8:27709782-27709804 ATCTGGCTAAGTGATGAAGTAGG - Intergenic
1044326289 8:90862317-90862339 GTGTGGCTAGGTAATGAAGTGGG + Intronic
1046539153 8:115556709-115556731 ATCTGGCAACTTAATGAAGTTGG + Intronic
1048885075 8:138903255-138903277 ATGTGGCTATTAAATGAAAGAGG + Intronic
1050997146 9:12234708-12234730 ATTTGGCCACTTCATGAAATGGG - Intergenic
1056257837 9:84818520-84818542 ATGTGGCACAGTAGTGAAATTGG + Intronic
1189193685 X:39134064-39134086 ATGTGACTTTGTAATGAAATGGG + Intergenic
1195236471 X:102904139-102904161 ACCTGGCTACCTCATGAAATAGG + Intergenic
1198892461 X:141413447-141413469 ATCTAGCTACATAATTAAATGGG + Intergenic