ID: 1173801809

View in Genome Browser
Species Human (GRCh38)
Location 20:45898832-45898854
Sequence CTGTGGCACTGGGGGTTAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173801809 Original CRISPR CTGTGGCACTGGGGGTTAGA GGG Exonic
900534775 1:3171462-3171484 CTGCGGCACTGAGGGTTTGGAGG - Intronic
901829717 1:11884898-11884920 CTGAGGGACTGGGAGTTCGATGG - Intergenic
902266760 1:15272536-15272558 CCGGGCCACTGGGGGATAGAGGG + Intronic
902551875 1:17224183-17224205 CTGTGGTTCTGGGAGTTGGAGGG - Intronic
903744801 1:25579629-25579651 CTGTGGCACTGGGCGATTCAAGG - Intergenic
905179073 1:36155767-36155789 CTCTGGCACTGGGGCTGAGAGGG - Intronic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
906919670 1:50049636-50049658 CTGTGGCACTGTGGCTTATGGGG + Intronic
907460890 1:54604810-54604832 CTGTGCCACTGGGGCTTGGATGG + Intronic
909456178 1:75852032-75852054 CTGGGGAAACGGGGGTTAGAAGG - Intronic
910371341 1:86519036-86519058 CTTTGTCACTGTGGGCTAGATGG + Intergenic
911149305 1:94581780-94581802 CTGTGGGAATGGGGCTTTGAAGG + Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912570301 1:110616358-110616380 CTGTGGGACAGCGGGGTAGAGGG + Intronic
914679007 1:149926002-149926024 AGGTGGCACTGGGGGTGGGAAGG + Exonic
914988783 1:152480740-152480762 CTGTCTCACTGGGGGTGACAGGG + Intergenic
915648163 1:157288621-157288643 CTGTGGCAAGGGGAGTCAGACGG + Intergenic
916608011 1:166362170-166362192 CTGGGGATCTGAGGGTTAGATGG - Intergenic
918137473 1:181687139-181687161 ATCTGCCACTGGAGGTTAGATGG - Intronic
923096817 1:230781594-230781616 CTGTGGCACAGGGGGAAAAATGG + Intronic
923537239 1:234862722-234862744 CTGTAGCACTGAGGGCTGGAGGG - Intergenic
923977289 1:239277496-239277518 CTCTGACACTGAGGGTCAGAGGG + Intergenic
924627496 1:245707913-245707935 CAGTAGCACTAGGGGTTGGATGG - Intronic
1063422215 10:5922035-5922057 CTGTTTCACAGGGAGTTAGAAGG + Intronic
1063896010 10:10682965-10682987 GTGTGGCACTGGGGGCTTGCTGG - Intergenic
1064350619 10:14573098-14573120 CTGCGGCACTGGGAGGTAGCTGG - Intronic
1065867867 10:29929190-29929212 CTTTGGCACTGGGCCTGAGAAGG + Intergenic
1066300446 10:34091279-34091301 CTGTGTCCATGGGGCTTAGAAGG - Intergenic
1068774152 10:60853330-60853352 CTTTGGCACTGGGTGTTACATGG - Intergenic
1069605993 10:69739120-69739142 CCCTGGCAGTGGGGGTGAGATGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1076159580 10:128233235-128233257 CTCTGGCCCTGGAGGTTAAATGG + Intergenic
1077506308 11:2931411-2931433 CTGTGCCCCTGGGGTTTAGAGGG - Intergenic
1077635693 11:3840449-3840471 TTGTGACACTTGGGGTGAGAGGG - Intronic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1079545131 11:21624684-21624706 CTGTGGCACTGGACATGAGATGG + Intergenic
1081160562 11:39743374-39743396 TTGTGGCAGTGGGGGTCAGTGGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083419316 11:62544490-62544512 CTGTGGGAATGTGGGTTAGAGGG - Intronic
1085274279 11:75288319-75288341 CTGAGGCACTGAGGGTTTGGGGG + Intronic
1088985875 11:114907806-114907828 CTCTGCTTCTGGGGGTTAGATGG + Intergenic
1089466124 11:118687790-118687812 CTGGGGCACTTGGGGTAGGAGGG + Intergenic
1089738086 11:120563712-120563734 ATGTGGCACTCAGGGTTAGTTGG + Intronic
1090489400 11:127145057-127145079 ATGGGGCACTGGGGCTTGGAGGG - Intergenic
1092264516 12:6970559-6970581 CGGCGGCACTGGAGGTCAGAAGG + Exonic
1093023105 12:14221018-14221040 CTGCTGAACTGGGGGGTAGAAGG - Intergenic
1094709617 12:32948439-32948461 CTGATGTACTGGGGGTGAGATGG + Intergenic
1097161089 12:57047248-57047270 CAGTGATTCTGGGGGTTAGATGG + Intronic
1100271454 12:93029237-93029259 CTGGAGCCCTGGGGGTGAGAGGG - Intergenic
1102268421 12:111507890-111507912 CTGTGTCACTCAGGGTTAAATGG + Intronic
1102710063 12:114918078-114918100 CAGTGGCATTGGGGGTTGGGGGG - Intergenic
1103011445 12:117461381-117461403 CCCTGGCACAGGGAGTTAGAAGG - Exonic
1103262275 12:119597676-119597698 CTGGGGTCCTGGGGGTTAGGAGG + Intronic
1103551945 12:121744355-121744377 CTGTGGCCCTGGGCGGTGGAGGG + Intronic
1105624714 13:22101623-22101645 CTGTAGTTCTGGGGGTTCGAGGG - Intergenic
1110677503 13:78266846-78266868 CTGTGGAACAGGGGGCTAGGTGG + Intergenic
1112095708 13:96129675-96129697 CTGAGGTACTGGGGATTAGGAGG - Intronic
1113035477 13:106043096-106043118 CAGTTTCACTGGAGGTTAGAAGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114200093 14:20511999-20512021 GTCTGGCACAGGGAGTTAGAGGG + Intergenic
1114319634 14:21536720-21536742 CTTGGTCACTGGGGGTTTGAAGG - Intronic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1121844387 14:97160093-97160115 CTGTGGCACTGGGTATTTGCCGG + Intergenic
1122084492 14:99290257-99290279 CTGAGGCCCTGGGGGGTTGAAGG - Intergenic
1122197887 14:100103140-100103162 CTGTGGCTCTGGGGCTTAAGAGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122715145 14:103692245-103692267 CTGTGACACTGGGGGCTCTAGGG - Intergenic
1122726993 14:103762719-103762741 CGGTGGCCGTGGGGGTGAGACGG + Intronic
1124022833 15:25939617-25939639 CAGGGGCAGTGGGGGTTAGATGG + Intergenic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127619297 15:60717501-60717523 CTATGGCACTGGCAGTTAGAAGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1132467306 16:83267-83289 CTGGGGCACGGGGGGTTGGAGGG + Intronic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1136278092 16:29191429-29191451 CTGTGTCACTGTGGCTCAGAGGG + Intergenic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138228224 16:55317270-55317292 CTGTCACTCTGGGGGTTATATGG - Intergenic
1139657757 16:68399339-68399361 ATGGGGCAGTGGGGGTAAGAAGG - Intronic
1140950854 16:79816090-79816112 CTGTGGCGCTGGGGTTTATCAGG - Intergenic
1141145191 16:81524313-81524335 CTGTCCCACTGGAGCTTAGAGGG + Intronic
1141280427 16:82626224-82626246 CTTTGGGACTGAGGGTAAGAGGG - Intergenic
1141459403 16:84168904-84168926 CTGAAGCACTGGGGGTTTAAGGG - Intronic
1141540165 16:84713938-84713960 CTGCAGCACTGGGGGTTGGCTGG + Intronic
1141774253 16:86111584-86111606 CTGAGGCACTGGGAGGGAGAGGG + Intergenic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142082468 16:88157469-88157491 CTGTGTCACTGTGGCTCAGAGGG + Intergenic
1143450452 17:7033528-7033550 CTGTGGCACAGGGTGTCACATGG + Intergenic
1143659875 17:8318327-8318349 CTGTGGCCCTGGGATTCAGAGGG - Intronic
1146128383 17:30248284-30248306 CTGTGGAACTGGGGATTGGGTGG - Exonic
1146269519 17:31475505-31475527 CTGTGTCACAGGGGTTTTGAGGG - Intronic
1147256483 17:39185051-39185073 ATGTGGGAATGGGTGTTAGAAGG + Intronic
1147638077 17:41976037-41976059 CTGTTGCAGTGTGGGTTCGAGGG - Exonic
1148103226 17:45105368-45105390 CTGTGGCACTGGGGGAGGAAGGG - Intronic
1149725003 17:58884253-58884275 CTGTGGAACTGGGGGTAAGTTGG - Intronic
1150569511 17:66373983-66374005 CTGCTGCAGTGGGGGTTTGAGGG + Intronic
1151806747 17:76410463-76410485 CTGTGGCACTGCGGGTGCGTTGG - Intronic
1154120880 18:11651638-11651660 ATGAGTCACTGGGGGTGAGAGGG + Intergenic
1157268798 18:46252959-46252981 TTGTGGCACTGGGGGATGTAAGG - Intronic
1157451874 18:47795189-47795211 CTGGGGCACTCGGGGTTGGGCGG + Intergenic
1160534877 18:79586449-79586471 CCGTGGCACTGGGGGGGAAAAGG + Intergenic
1160753250 19:745196-745218 CTGGGGAACTGGAGGTTACAGGG - Intronic
1160923212 19:1530147-1530169 CTGGGACACTGGGGATAAGAGGG - Intronic
1161482896 19:4519563-4519585 CTGTGTTATTGGGGGTGAGAGGG + Intergenic
1162077136 19:8195496-8195518 ATGTGGCATTGGATGTTAGAAGG - Intronic
1165830665 19:38728780-38728802 CTGGGGCACTGGGGGCTTGGAGG + Intronic
1166890952 19:45992704-45992726 GGATGGAACTGGGGGTTAGAGGG - Intergenic
1167728225 19:51233720-51233742 CAGTGGCACTGGAGGTTGGTTGG + Intronic
925755158 2:7126763-7126785 CTGTGGCAGCTGGGGCTAGAAGG + Intergenic
927029819 2:19109019-19109041 ATGTGTGACTGAGGGTTAGAAGG + Intergenic
927865324 2:26584200-26584222 CTGAGGCACAGAGGGTTATATGG + Intronic
930678705 2:54232552-54232574 CTTTGACACTGGGGGCAAGACGG - Intronic
930909237 2:56610840-56610862 CTGTGGCTCTGGTGGTTGAAGGG - Intergenic
931652217 2:64479006-64479028 CAGAGCCACTGGGGGTTGGATGG - Intergenic
933708131 2:85306437-85306459 TTGTGCCACTGGGGGAGAGAGGG - Exonic
935249555 2:101249694-101249716 CTATGCCACTGGTTGTTAGAAGG - Intronic
935584230 2:104786014-104786036 CTGTGCCACTGTGGGTTTCAGGG - Intergenic
936814919 2:116448310-116448332 TTGTGGGACTGAGTGTTAGAGGG + Intergenic
945660337 2:212677991-212678013 GTGTGGCACTGGTGATCAGATGG + Intergenic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
946969418 2:225075136-225075158 CTGTTGCACTGGGGGTGAGGAGG - Intergenic
948650353 2:239439892-239439914 CTGTGGCACTGGGGCATGGCGGG + Intergenic
1171949788 20:31410924-31410946 CTGTGCCACTGGGGGTTCCTTGG - Intronic
1173115854 20:40242007-40242029 GTGTGGCACACGGAGTTAGAAGG - Intergenic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1174134132 20:48367366-48367388 TTGTGGCAGTCGGGGTTAAATGG + Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178366384 21:31992197-31992219 CTGTGCAACTGGGGGTATGATGG - Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1183304679 22:37076273-37076295 CTGTGACACTGTGGGCTTGAGGG + Intronic
1184203110 22:42982603-42982625 CTGTGTCACTCAGGGTTAAATGG + Intronic
950101510 3:10359735-10359757 CTGTGGCTCTGGGTGCTAGACGG + Intronic
950408322 3:12818064-12818086 CTATGGGACTGTGGGATAGAAGG + Intronic
958901380 3:99891151-99891173 CTATGGCATTGGGAGTTAGAGGG - Intronic
961368818 3:126417536-126417558 CAGGGGGAATGGGGGTTAGACGG + Intronic
961523904 3:127484409-127484431 CAGTGGCACCGGGTGTTAGCTGG - Intergenic
964836858 3:160948722-160948744 CTGTGGCACTGAGGGTTGAAAGG + Intronic
969368010 4:6710794-6710816 CTGTGGCACTTGTGTTAAGAAGG - Intergenic
970014989 4:11503497-11503519 CTGAGGCTCTCAGGGTTAGAGGG + Intergenic
970546259 4:17133445-17133467 CTGAGGCACTGAGAGTTGGAGGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972398643 4:38679671-38679693 CAGTGGCACGGGGGATTTGATGG + Intronic
975102566 4:70531194-70531216 CTGTGCCACTGGGAGTTGGGAGG - Exonic
975748012 4:77493539-77493561 CTTTTGAAATGGGGGTTAGAGGG + Intergenic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
977797507 4:101184821-101184843 CTTTAGCACTTGGAGTTAGAAGG + Intronic
979024703 4:115554244-115554266 CTCTGGGACTGGGGGTTGGTAGG + Intergenic
980792909 4:137642650-137642672 CTGTGGAACTTGGGGTGTGAGGG + Intergenic
982527971 4:156503905-156503927 CTGTCCCACTGGGAGTGAGAAGG + Intergenic
983259615 4:165441461-165441483 CTGTGGTACTGGGGTTTTGGGGG + Intronic
984507366 4:180636602-180636624 CTGTTCCCCTGGAGGTTAGAAGG + Intergenic
984923771 4:184788413-184788435 CTGTGGCCCTGGGGGCTCCATGG - Intronic
989210627 5:38855690-38855712 CGGTGGCAGTGGGGGTTGGGGGG - Intronic
989575543 5:42984518-42984540 CTGTTGCACCAGGGCTTAGAGGG - Intergenic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
994593281 5:101799410-101799432 TTATGGCACAGGGGGATAGATGG - Intergenic
998160566 5:139810717-139810739 CTGTGGCACTGGGTGTGCCATGG + Intronic
998160980 5:139812934-139812956 CTGTGGCACTGGGTGTTCCATGG + Intronic
999060667 5:148631136-148631158 CTGTGCCACTTGGGGTTATGGGG - Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999779980 5:154841394-154841416 CTGTGGACTTGGGGGTTAGAGGG + Intronic
1000278238 5:159758760-159758782 ATGTGGTACTCGGGATTAGAAGG + Intergenic
1000983554 5:167842614-167842636 CTGAGGAACTGGGGGATAAAAGG - Intronic
1002192030 5:177483414-177483436 TTGTGGCACTGGAGGTGAAAGGG + Exonic
1002957126 6:1877147-1877169 CTGTGCCTCTGGCTGTTAGATGG - Intronic
1003173577 6:3738533-3738555 CTGTGTCACTGGGGGTGGGCTGG - Intronic
1003244680 6:4374017-4374039 ATGTGGCACTGGGGGTTTACTGG - Intergenic
1007769338 6:44180511-44180533 CTGTAGGGCTGGGGGTTGGAAGG + Intronic
1016374489 6:143406476-143406498 GTGGGGCAGTGGGGGTTGGAAGG + Intergenic
1018373780 6:163192090-163192112 CAGAGTCTCTGGGGGTTAGAGGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1024492666 7:50003421-50003443 CTGTGCCACTGGAGGTGAGGTGG - Intronic
1026501654 7:70947860-70947882 CAGTGGCACTGGTAGTCAGATGG - Intergenic
1026554911 7:71399329-71399351 CTTTGGAACTGGGGGTAAAATGG - Intronic
1027266658 7:76498441-76498463 CTGTGGCACTCGGGTTTACCTGG + Intronic
1027318038 7:76996558-76996580 CTGTGGCACTCGGGTTTACCTGG + Intergenic
1027653014 7:80894558-80894580 CATTAGCACTGGGGGTTTGAAGG + Intronic
1027805856 7:82821295-82821317 CTGTGGCAGTGTGGGTGAAATGG + Intronic
1027960434 7:84939662-84939684 CTGTGGCCCTGGGGGTAGGTGGG + Intergenic
1033858219 7:145592002-145592024 CTGTGGCAGTTGGTGTTATATGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035193440 7:157193368-157193390 CTGTGGCACCTGGACTTAGAGGG + Intronic
1035254627 7:157618487-157618509 CTGTGGCTCTGTGGCTTGGAAGG - Exonic
1036754180 8:11461444-11461466 TGGTGGCAGTGGGGATTAGAGGG + Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037769261 8:21789333-21789355 CAGGGGCAGTGGGGGTTGGAGGG - Intronic
1038642654 8:29340148-29340170 CTGTGGCACTGGGGGGAACCGGG + Exonic
1040088270 8:43367755-43367777 GTGTGGCACTGCAGGTGAGATGG - Intergenic
1042692738 8:71520663-71520685 CTCTGGCCCTGGGGGTGTGAAGG - Intronic
1044657881 8:94567182-94567204 CAGTGGGACTTGGGGTTATATGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1047516078 8:125556116-125556138 GTGTGGCACTGGGGGATCCAGGG + Intergenic
1047817288 8:128478586-128478608 ATGTGGCACCCTGGGTTAGATGG - Intergenic
1048678554 8:136812728-136812750 CCATGGCACTGGGCATTAGAAGG + Intergenic
1049253319 8:141600934-141600956 CGGTGGCAGTGAGGGGTAGATGG - Intergenic
1049289182 8:141792449-141792471 CTGTGGCCCTGGGGGCTCCATGG - Intergenic
1050212330 9:3274761-3274783 CTGGGTGACTGGGAGTTAGAGGG - Intronic
1053376794 9:37614226-37614248 ATGTGGGACTGAGGGGTAGAGGG + Intronic
1058645438 9:107127548-107127570 CTGTGGTGCTGGGGGTTGCAGGG + Intergenic
1059383760 9:113948499-113948521 CTGTAGCCATGGGAGTTAGAAGG + Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060447968 9:123709275-123709297 CTGGGGCACTGGTGCTCAGAGGG - Intronic
1060710365 9:125857519-125857541 ATGTAGTACTGGGGGTCAGATGG - Intronic
1061188174 9:129067253-129067275 CTGGGACCCTGGGGGTTAGCTGG - Intronic
1062365691 9:136207969-136207991 CTGTGGACCTGGGGGTTGGAAGG - Exonic
1186800751 X:13090253-13090275 GTGTGGATCTGGGGGATAGAAGG - Intergenic
1190335262 X:49258206-49258228 CTGTGGCACTGGGCGGGAGGGGG - Intronic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1192149634 X:68704215-68704237 CTGAGCCACTGGGTGTTAGGGGG + Intronic
1195356958 X:104048225-104048247 CTGTGGAACAGGGGTCTAGAAGG + Intergenic
1200256381 X:154585221-154585243 CCGGGGCACAGGGGGTTCGACGG + Exonic
1200261388 X:154619182-154619204 CCGGGGCACAGGGGGTTCGACGG - Exonic
1200267371 X:154653479-154653501 CCGGGGCACAGGGGGTTCGACGG - Exonic