ID: 1173802411

View in Genome Browser
Species Human (GRCh38)
Location 20:45902606-45902628
Sequence TGGGGGATGAGCAGCAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 1, 2: 2, 3: 94, 4: 719}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173802399_1173802411 20 Left 1173802399 20:45902563-45902585 CCGCAGCTCCAGCTTCAATGGGG 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 94
4: 719
1173802397_1173802411 21 Left 1173802397 20:45902562-45902584 CCCGCAGCTCCAGCTTCAATGGG 0: 1
1: 0
2: 0
3: 27
4: 260
Right 1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 94
4: 719
1173802395_1173802411 27 Left 1173802395 20:45902556-45902578 CCAGGACCCGCAGCTCCAGCTTC 0: 1
1: 0
2: 5
3: 54
4: 585
Right 1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 94
4: 719
1173802401_1173802411 12 Left 1173802401 20:45902571-45902593 CCAGCTTCAATGGGGAGTCAATC 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 94
4: 719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173802411 Original CRISPR TGGGGGATGAGCAGCAGGGG CGG Intronic
900010442 1:102421-102443 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
900026547 1:278986-279008 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
900036333 1:412829-412851 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
900057961 1:648584-648606 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
900116412 1:1029534-1029556 TGGGGGTCAAGGAGCAGGGGTGG + Intronic
900143728 1:1149323-1149345 TGTGGCATGAGCAGCCGAGGGGG + Intergenic
900291216 1:1924349-1924371 TGGGTGGTGAGCTGCGGGGGTGG - Intronic
900586882 1:3436950-3436972 TGGGGTCTGAGGAGCAGCGGAGG - Exonic
900851842 1:5149963-5149985 TGGGGGATGAGAAACAGTGATGG - Intergenic
900989207 1:6090365-6090387 TGGGGGAGGACCAGGTGGGGGGG - Intronic
900996329 1:6125300-6125322 TGGGGGAAGAAAAGCATGGGAGG + Intronic
901018689 1:6245358-6245380 TCGGGGAGGAGGAGCAGGGGTGG - Exonic
901122633 1:6907805-6907827 TGGGGCAGGAGCAGAAGGGCTGG - Intronic
901324983 1:8360529-8360551 TGAGGCATGAGTTGCAGGGGTGG + Exonic
901741187 1:11343030-11343052 GGGGAGAGGAGCAGGAGGGGAGG + Intergenic
901925008 1:12560577-12560599 TGGTGAGTGAGGAGCAGGGGAGG - Intergenic
902449981 1:16490861-16490883 TGGAGGAGGAGCCGCAGAGGTGG - Intergenic
902472162 1:16656730-16656752 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
902486641 1:16750716-16750738 TGGAGGAGGAGCAGCAGGGAGGG + Intronic
903284970 1:22270980-22271002 TGGGGGATGGGGGGCAGTGGTGG + Intergenic
903315238 1:22498545-22498567 TCTGGGAAGAGAAGCAGGGGTGG - Intronic
903345184 1:22679957-22679979 TGGGGGAGGAGCAGCTGGAAGGG - Intergenic
903377665 1:22876720-22876742 TGGGCGGTGGGCAGCAGGAGGGG + Intronic
903576560 1:24342969-24342991 TTGGGGATGAACAGCACGGGTGG - Exonic
903579875 1:24362796-24362818 TGGTGGAGGAGCAGCTGGCGTGG + Intronic
903668187 1:25020810-25020832 TGTGCAATGGGCAGCAGGGGTGG - Intergenic
903818417 1:26082016-26082038 TAGGGGCAGAGGAGCAGGGGTGG + Intergenic
904009386 1:27381159-27381181 TGGGGGATGAGGAGCAGAAGAGG + Intronic
904324787 1:29721365-29721387 TGGGGGCTGGGCAGTAGGAGAGG - Intergenic
905169342 1:36099939-36099961 TGGGGAATGAGGAGCTGTGGAGG + Intronic
905275502 1:36815304-36815326 TGGGGGCTGGGCAGCGGGGAGGG + Intronic
905896005 1:41546130-41546152 TGGAGGGTGGGCAGCAGGGCGGG + Intronic
906153390 1:43600598-43600620 TGGGGGATGAGCTGAGGGGATGG - Intronic
906247043 1:44283616-44283638 TGGGAGATCAGCAGGAGAGGGGG + Intronic
906276529 1:44520633-44520655 TGGGGGAAGAGCAGTAGGGAAGG - Intronic
906511743 1:46413967-46413989 TGGGTGATGGGCACCAGGGGAGG - Intergenic
906659301 1:47571301-47571323 AAGGGGAAGAGCAGCGGGGGTGG + Intergenic
907084402 1:51656636-51656658 AGGGGGAGGAGAAGCAGGAGTGG - Intronic
907476818 1:54711304-54711326 TGTGGGATGCTAAGCAGGGGAGG + Intronic
907710522 1:56876436-56876458 AGGGAGATGAGCAGTAGGGTAGG - Intronic
908249490 1:62253929-62253951 TGAGGGATGAGCACCAGAGCCGG - Intronic
908571984 1:65420292-65420314 TGGGGCGGGACCAGCAGGGGAGG + Intergenic
910111803 1:83691464-83691486 AGGGGGATGAGAAGCCGGTGTGG + Intergenic
910731827 1:90406141-90406163 TGGGGCATGAGCAGTAGTGAGGG - Intergenic
911178785 1:94843099-94843121 TAGGGGAAGAGGAGCAGGGCTGG + Intronic
912453540 1:109783070-109783092 TGAAGGATGGGCAGCGGGGGTGG - Intergenic
912492875 1:110071485-110071507 TGGAGGATGAGCAGAAGGGCTGG + Intronic
912618771 1:111134051-111134073 TGGGGCAGCAGGAGCAGGGGCGG + Intronic
912759044 1:112349900-112349922 TGGGGGTTGGGGGGCAGGGGAGG - Intergenic
913533186 1:119747690-119747712 AGGAGGAGGAGAAGCAGGGGAGG - Intergenic
913551419 1:119920473-119920495 TGGGAGATAAGCAGCGGTGGTGG - Intronic
914247567 1:145897289-145897311 CCGGGCATGAGCAGAAGGGGCGG + Exonic
914753596 1:150551022-150551044 AGTGGGATGAGGAGCAGGGGTGG + Intronic
914815325 1:151058715-151058737 TGGGAGGTGAGCAGAAGGGATGG + Exonic
914901888 1:151715539-151715561 TGGGAGATAAGCAGCTGGGTAGG - Intronic
915012151 1:152697881-152697903 TGAGGGCTGAGCAGAAGGGGAGG + Intergenic
915243571 1:154541186-154541208 TGCTGGAGGAGCAGCAGGGTGGG + Intronic
915725177 1:158012078-158012100 TTGGGGAAGGGAAGCAGGGGTGG - Intronic
916578997 1:166091070-166091092 TGAAGGATGAGCAGCAGAGGAGG + Intronic
916597493 1:166258191-166258213 TGGTGGCTGAGCCTCAGGGGTGG + Intergenic
916739703 1:167637497-167637519 TGGGGGAAGAGCAGCACTTGTGG - Intronic
916786324 1:168089667-168089689 CTGGGGATGGGCAGCAGGTGTGG + Intronic
917135081 1:171781721-171781743 TGGGGAAGGAACAGCAGGCGCGG + Exonic
917974476 1:180230093-180230115 TGGGGGATGTGCCGAAGGGCGGG + Intergenic
918107266 1:181425690-181425712 TGGGGTATGAGCGGCTGAGGTGG - Intronic
920182696 1:204142340-204142362 TGGGGGTGGGGCAGCAGGAGAGG - Intronic
920232217 1:204478218-204478240 TGGGGGATGGACAGAAGTGGAGG - Intronic
920689139 1:208132317-208132339 TGTGGGGAGAGCAGGAGGGGAGG + Intronic
920857599 1:209675629-209675651 TGCAGGAGGAGCAGCAGGAGAGG - Intronic
920871069 1:209795466-209795488 TGGTGGGTCAGCTGCAGGGGTGG - Intronic
920917631 1:210270792-210270814 TGGGGAATAAACAGCAGGAGAGG + Intergenic
921358937 1:214312729-214312751 TGGGGGATGATGGGCTGGGGTGG + Intronic
922132637 1:222795035-222795057 TGGAGGAGGGGCAGGAGGGGAGG - Intergenic
922258881 1:223918427-223918449 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
922466287 1:225847271-225847293 TGGGAGAAGGGCAGGAGGGGAGG - Intronic
922675162 1:227545056-227545078 TGAGGGCTGAGGAGCTGGGGTGG - Intergenic
922768082 1:228166259-228166281 TGGGGGGTGGGCACCCGGGGAGG + Intronic
923051584 1:230394400-230394422 TGGGGTGTGGGCAGCGGGGGAGG - Intronic
923644551 1:235804452-235804474 TTGGGTATGACCAGCAGAGGCGG - Intronic
923656379 1:235920733-235920755 TGGCTGATGAGCCGCAGAGGAGG + Intergenic
924340070 1:243021176-243021198 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
924350002 1:243105708-243105730 AGGGGAAAGAGCAGCAGGAGGGG + Intergenic
924854728 1:247864883-247864905 TGGCGGATGAGCTGCAGGAGAGG + Exonic
1063309620 10:4940097-4940119 AGGGGGCTGAGGAGCAGGGCGGG - Intronic
1063317676 10:5022006-5022028 AGGGGGCTGAGGAGCAGGGCGGG + Intronic
1063407736 10:5813170-5813192 CCGGGGCTGAGCAGCCGGGGCGG - Intronic
1064293109 10:14053449-14053471 TGGGGGTAGATCAGCAGGGCTGG - Intronic
1064979207 10:21149202-21149224 TGGAGGGGGTGCAGCAGGGGAGG + Intronic
1065967050 10:30779074-30779096 AGGAGGAAGAGCAGGAGGGGAGG + Intergenic
1066047028 10:31603413-31603435 CGGGGGATGAGCTGCAAGGCTGG + Intergenic
1066352404 10:34648668-34648690 CAGGAGGTGAGCAGCAGGGGAGG - Intronic
1066362018 10:34740255-34740277 TGGGAGCTGAGCTGCAGGAGAGG + Intronic
1066583078 10:36901711-36901733 TGGGGGATGATGACCAGGTGAGG - Intergenic
1067000102 10:42602943-42602965 TGGGGGTTGAGGAGCACTGGTGG - Intronic
1067200507 10:44167728-44167750 TGGGGGATGGGGGGAAGGGGAGG - Intergenic
1067541035 10:47153366-47153388 TGGGAGGAGAGCAGCAGGAGAGG - Intergenic
1067932473 10:50576483-50576505 AGGGGGATGAGAAGAAAGGGTGG - Intronic
1068891956 10:62157086-62157108 CGGGGGAGGGGGAGCAGGGGAGG + Intergenic
1069749604 10:70736799-70736821 TGTGGGGTGTGCAGCAGGAGTGG + Intronic
1070824850 10:79385140-79385162 TGGGGGATGAAAAGCAGGGCTGG + Exonic
1071263301 10:83940720-83940742 TTGGGGAAGACCAGCAGGGCAGG + Intergenic
1071514335 10:86287161-86287183 TGGGGAAGGAGCTGCAGGTGAGG + Intronic
1071785941 10:88899869-88899891 TGGGGAATGTGAAGCCGGGGAGG - Intronic
1073077993 10:100836521-100836543 CAGGGGGTGGGCAGCAGGGGAGG + Intergenic
1073251132 10:102120809-102120831 TGGGGGAGGCGGAGCCGGGGTGG + Intergenic
1073592775 10:104772227-104772249 AGGGGATTGTGCAGCAGGGGTGG + Intronic
1073876567 10:107929705-107929727 TAGAGGAAGAGCAGCAAGGGAGG + Intergenic
1074417419 10:113279413-113279435 TGGGTGGTGAGTTGCAGGGGCGG + Intergenic
1075600594 10:123765792-123765814 TGGAGGAGGAGCAGCAGGGTGGG - Intronic
1075918667 10:126191380-126191402 ATGGGGGTGAGCAGCAGGAGGGG + Intronic
1075919502 10:126198595-126198617 CTGGGTAGGAGCAGCAGGGGAGG - Intronic
1075984443 10:126771524-126771546 AAGAAGATGAGCAGCAGGGGTGG - Intergenic
1076004680 10:126939043-126939065 GGGGGGATGAACACCGGGGGGGG + Intronic
1076202551 10:128569880-128569902 GAGGGGATGGGCAGGAGGGGAGG - Intergenic
1076372955 10:129966863-129966885 TGGGGCAGGAGCAGCAGCAGAGG + Intergenic
1076379576 10:130015799-130015821 TGGGGATTGGGGAGCAGGGGTGG + Intergenic
1076425006 10:130361484-130361506 AGGGGAAGGAGCAGGAGGGGAGG + Intergenic
1076609315 10:131711297-131711319 GGTGGGATGGGCAGCAGGTGTGG - Intergenic
1076667948 10:132103439-132103461 GGGGAGAGGAGCAGCTGGGGGGG + Intergenic
1076667955 10:132103458-132103480 GGGGGGAGGAGCAGCTGGAGGGG + Intergenic
1076802180 10:132835873-132835895 TGGGGAAGGGGGAGCAGGGGCGG - Intronic
1076871767 10:133198132-133198154 TGGGGGAGGGCCAGCAGGCGGGG - Intronic
1076902844 10:133348178-133348200 TGGGAGGTGGGCACCAGGGGTGG + Intronic
1077204576 11:1336410-1336432 TGGGCGGTGAGCAGCGGGGCGGG - Intergenic
1077253080 11:1569160-1569182 TGGGGGGTGAGAGGCAGGGCTGG + Intronic
1077445333 11:2588059-2588081 TGGGAGGGGAGCAGCAGGGGAGG + Intronic
1077463795 11:2723900-2723922 TGGGGGATGTGCCGCAGGGATGG + Intronic
1077497329 11:2892556-2892578 TGGGGGAGGGGCGGCAGGGCGGG - Intronic
1077557253 11:3231616-3231638 AGGGGGAGGAGAAGGAGGGGAGG + Intronic
1077842259 11:5987757-5987779 TGGGGGTTGAGAAGAAGGAGTGG - Intergenic
1077985370 11:7346327-7346349 GAGAGGATGAGCAGCAGAGGGGG + Intronic
1078735125 11:14012649-14012671 TGGGGGAGGAGGAACAGGAGTGG - Intronic
1078869174 11:15327978-15328000 TGGGGAATGAGCAGGAGTGGGGG + Intergenic
1079132594 11:17756335-17756357 TGGGGGAGGAGTAGGAGAGGGGG - Intronic
1080114554 11:28607115-28607137 GGGCGGATGGGCCGCAGGGGAGG + Intergenic
1080423424 11:32134047-32134069 TGGGGGTAGAGCAGAAGGGAGGG + Intergenic
1081446957 11:43139966-43139988 TGGGGAATCATCAGCATGGGGGG - Intergenic
1083326845 11:61877285-61877307 GGGGGGTTGAGGAACAGGGGGGG - Intronic
1083651578 11:64207599-64207621 CGGGAGCTGAGCAGCAGGGATGG - Intronic
1083827317 11:65211041-65211063 TGGGAAAGGAGCAGGAGGGGAGG + Intronic
1083994456 11:66265316-66265338 TGCCAGATGAGCAGCAGAGGAGG - Intronic
1084953964 11:72681521-72681543 TGGAGGAGGAGCAGGAGGGAAGG + Intergenic
1084968172 11:72755203-72755225 TGGGGGCTGAGCCGCTGGAGGGG - Intronic
1085052372 11:73386452-73386474 GGGGTGCTGAGCAGCAGGTGTGG + Intronic
1085237414 11:75025701-75025723 TGGGAGATGGGGGGCAGGGGTGG + Intergenic
1085287338 11:75372139-75372161 TGAGGGGTGAGGAGCAGGAGGGG + Intergenic
1085697611 11:78718493-78718515 TGGTGAATGTGCAGCAGGGCTGG + Intronic
1085787859 11:79470867-79470889 CTGGGGATGAGCTGGAGGGGAGG - Intergenic
1086134090 11:83429645-83429667 TGAGGGATGGCCAGCAGGGTGGG + Intergenic
1086720901 11:90119819-90119841 TTGGAGAGGAGCAGCAGGGAAGG - Intergenic
1087462611 11:98463774-98463796 TGGGGGATGGGGGGCAGGAGAGG + Intergenic
1088346115 11:108827707-108827729 TGGAGGATGGGGAGCAGGGTGGG - Intronic
1088911067 11:114192949-114192971 CGAGGGATGAGCAGCTGTGGAGG + Intronic
1088916436 11:114231401-114231423 TGAGGGCTGAGCAGTTGGGGTGG - Intronic
1089529450 11:119116852-119116874 GGAGGGATGAGGAGCAGGAGGGG - Exonic
1089616242 11:119696486-119696508 TGGGGGTGGGGCAGCTGGGGAGG - Intronic
1089744720 11:120608758-120608780 TGGGGGCAGAGGAGCAGGGCAGG - Intronic
1089983832 11:122794562-122794584 TGGGGGATGCTGAGCAGGAGTGG - Intronic
1090067973 11:123519469-123519491 TGAGAGAGGAGCAGCGGGGGAGG - Intergenic
1090205965 11:124884572-124884594 TGGGGGAAGAGCAGCAGGCAGGG + Exonic
1091079737 11:132655064-132655086 TGGGGGCTGAGCAACAGAGAAGG - Intronic
1091090251 11:132764295-132764317 TGGGCGGTGAGCAGCAATGGTGG - Intronic
1091858872 12:3760868-3760890 GAGGGGATGTGCAGGAGGGGAGG - Intronic
1092232364 12:6783255-6783277 TTGAGGATGGGGAGCAGGGGAGG - Intergenic
1093481810 12:19612106-19612128 TGGTGGATTAGCAGTAGGTGGGG + Intronic
1093561972 12:20552512-20552534 AGGAGGAGGAGCAGCAGGAGGGG + Intronic
1094807097 12:34105491-34105513 TGAGGGCTGAGAAGCTGGGGTGG + Intergenic
1096145818 12:49277818-49277840 TGGGGGCTGTGGAGCAGGAGTGG + Intergenic
1096178153 12:49536674-49536696 TGGAGGAGGAGGAGGAGGGGAGG - Intergenic
1096243705 12:49973016-49973038 TGGTGGAGGAGCTGCAGGTGGGG + Intronic
1096493120 12:52023692-52023714 AGGAGGAGGAGCAGCAGGGGAGG - Intronic
1096600020 12:52722470-52722492 TGGAGGGAGAGCTGCAGGGGAGG + Intergenic
1096847675 12:54417107-54417129 GGGGAGATGAGCAGAAGGGGAGG + Intronic
1096884019 12:54698913-54698935 TGGAGGAGGAGGAGCGGGGGTGG - Intergenic
1096914757 12:55019772-55019794 TGGTGGAAGGGGAGCAGGGGAGG - Intergenic
1097098754 12:56571251-56571273 TGGAGGAAGAGCAGGAGGAGGGG - Intronic
1098027892 12:66224447-66224469 TGGGGGATGAGCAGCAGAATAGG + Intronic
1098179817 12:67833857-67833879 AGGGGCATGTGCAGCAGAGGTGG + Intergenic
1099033613 12:77559562-77559584 AGGGGGATGGGGAGCAGGAGTGG + Intergenic
1099058161 12:77871430-77871452 TGGGGGATGGGGATTAGGGGAGG - Intronic
1100378562 12:94040722-94040744 TGAGCGGTGAGCAGCAGGGATGG - Intergenic
1101171112 12:102094949-102094971 TGAGGGATGAGGAGGAGGGATGG + Intronic
1101259454 12:103013569-103013591 TGGGGGTTGAGGGGCAGGTGAGG + Intergenic
1101777947 12:107810698-107810720 TGGGGGATGTGGACCAGGGCTGG + Intergenic
1101824603 12:108210325-108210347 TGAGGGAGGAGCAGCAGAGAGGG - Intronic
1102149535 12:110679228-110679250 TGGTGGATGTGCAGCCGAGGTGG + Intronic
1102484441 12:113246544-113246566 AGGGAGATGAGCAGCAGCGTGGG - Intronic
1102504499 12:113375029-113375051 TGGGGGATGAGCAGGTGGGTGGG + Intronic
1102531099 12:113547224-113547246 TGGGGGCTGAGAGGCAGGGATGG + Intergenic
1102933369 12:116878943-116878965 TGGGGCCTGCGCTGCAGGGGAGG - Intronic
1103340995 12:120221114-120221136 TGGGAGAAGAGTAGCAAGGGAGG + Intronic
1103567284 12:121823080-121823102 AGGGGGGCGGGCAGCAGGGGTGG - Exonic
1103743166 12:123105029-123105051 GAGGGGAAGAGAAGCAGGGGAGG - Intronic
1104668327 12:130663217-130663239 AGGGGGTGGAGCAGGAGGGGAGG - Intronic
1104751465 12:131242745-131242767 TCTGGGCTGAGCAACAGGGGAGG + Intergenic
1104948061 12:132425947-132425969 TGGCGGAGGAGCTGCAGGGGTGG - Intergenic
1106220132 13:27739977-27739999 TGTGGGATGAGCAGCAGATGCGG - Intergenic
1106555473 13:30804720-30804742 AGTGGCATCAGCAGCAGGGGTGG + Intergenic
1107135328 13:36938248-36938270 GGGCTGAGGAGCAGCAGGGGTGG - Intergenic
1108034776 13:46278685-46278707 GGGGGGATGGGGAGGAGGGGAGG + Intergenic
1108132405 13:47316770-47316792 TGGGGGGTGGGGAGAAGGGGAGG + Intergenic
1109151876 13:58857598-58857620 TGGGGGACCAGGAGCAGGGCTGG + Intergenic
1109525208 13:63566372-63566394 TGGGGGCTGATGAGCATGGGAGG + Intergenic
1110347430 13:74464869-74464891 TGAGGGAAAAGCAGCAGGGAGGG - Intergenic
1110569966 13:76992321-76992343 TGGGGGATGGGGTGCTGGGGCGG + Intronic
1111328485 13:86731412-86731434 TGGGGAAAGAGCACCAGGTGGGG + Intergenic
1112872792 13:103995384-103995406 TGGGGTAGGAGAAGCAGGGAGGG - Intergenic
1112936554 13:104806816-104806838 TGGGAAATGAGCAGAAGGGGAGG + Intergenic
1113070299 13:106413953-106413975 TGTGGGGTGAGCAGCAGCGGAGG - Intergenic
1113300332 13:109012285-109012307 CAGGGGGTGAGCAGCAGGTGAGG + Intronic
1113311961 13:109140746-109140768 GGGGGGAACACCAGCAGGGGCGG - Exonic
1113518901 13:110924323-110924345 TGTGGGATGGGCAGCAGGTGTGG - Intergenic
1113708300 13:112447904-112447926 AGGGGGCTGAGGAGCAGGAGTGG + Intergenic
1113748928 13:112765224-112765246 GTGAGGAGGAGCAGCAGGGGTGG + Intronic
1113815063 13:113163790-113163812 TGGTGGCTGAGCAGCTGGGATGG - Intronic
1114696129 14:24629519-24629541 AGGGGGAAGAGTAGCAGGGCAGG - Intergenic
1115092989 14:29601159-29601181 TGGGTGGTGAGCAGCAGAAGGGG + Intronic
1115753449 14:36512874-36512896 TGGGGGGTGGGGAGCAGGGAAGG + Intronic
1115820197 14:37205611-37205633 TGGGGGATGGGGAGCTGGCGGGG - Intronic
1116639720 14:47445736-47445758 TGAGGGATAAGCAGAAGGGGAGG + Intronic
1117930841 14:60838957-60838979 TGGGGAATGAGGAGCATGAGAGG + Intronic
1118346279 14:64943497-64943519 TGGGGGATGAGGTGGAGGTGGGG - Intronic
1119133079 14:72192605-72192627 TAAGGGAGGAGCAGGAGGGGAGG - Intronic
1119170195 14:72529141-72529163 TGGGGGAGGAGTTGCAGGGCAGG + Intronic
1119508999 14:75196592-75196614 TGGGAGGTGGGCAGCAGAGGGGG - Intergenic
1119771122 14:77221149-77221171 TGGGGCATGAGTGGGAGGGGAGG - Intronic
1119911519 14:78353771-78353793 TCGGAGATGAGCCTCAGGGGAGG + Intronic
1121792379 14:96708997-96709019 GGTGGGATTAGCAGCAGTGGTGG + Intergenic
1121792391 14:96709060-96709082 GGTGGGATTAGCAGCAGTGGTGG + Intergenic
1121792415 14:96709188-96709210 GGTGGGATTAGCAGCAGTGGTGG + Intergenic
1122397046 14:101441263-101441285 TGGGGGAGGAGCAGCCGGGAGGG - Intergenic
1122760430 14:104020894-104020916 TGGGGCATGAGGAGCAGGCATGG - Intronic
1122977945 14:105178653-105178675 TGGGGGATGAGCAGCTGGCCTGG - Intronic
1123684286 15:22786531-22786553 TGGGGGAGGAGCAGGAAGAGGGG - Intronic
1124233907 15:27970391-27970413 TGGGGGAAAAGCAGTAGTGGAGG + Intronic
1124254666 15:28130981-28131003 CGGGGGAGGAGCAGCAGGCAAGG + Intronic
1124338817 15:28876719-28876741 TGGAGGAGGAGCAGGAGGGGTGG + Intergenic
1124883242 15:33661103-33661125 TGGGTCACGAGCAGCAGGGCAGG + Intronic
1124957850 15:34371183-34371205 TGGGGGAAGAGGAGTAGGAGAGG - Intergenic
1124971181 15:34490683-34490705 AGCGGGAGGAGCAGCAGAGGCGG - Intergenic
1126156926 15:45574369-45574391 TGGGTGATGAGGATCATGGGAGG - Intergenic
1127130306 15:55855442-55855464 TGGGGGATAAGGAGAAGGGTAGG + Intronic
1127778107 15:62284779-62284801 TGGGTGATGGGCAGTAGGGTTGG - Intergenic
1128062284 15:64742673-64742695 TGGGGGATGAGCATCCAGGGAGG + Intronic
1128989863 15:72250812-72250834 TGGGGGCTGGGCAGTGGGGGTGG - Intronic
1129057992 15:72835739-72835761 AGGGGGAAGAGGAGCAGGGGAGG + Intergenic
1129441389 15:75583451-75583473 TGGGGGATGGGCAAAAGGCGAGG - Intergenic
1129910934 15:79225750-79225772 TGGAGGTTGTGCAGCAGGGTTGG + Intergenic
1130096899 15:80862694-80862716 AGGTGGATGAGGAGCAGGGGTGG + Intronic
1131026762 15:89149500-89149522 AGGTGAATGAGCAGCAGGAGGGG + Intronic
1131067754 15:89444753-89444775 GGGGGGAGGGACAGCAGGGGAGG - Intergenic
1131544558 15:93305243-93305265 TGGGCGAGGGGCGGCAGGGGTGG + Intergenic
1132346329 15:101111318-101111340 TGGGGGAGAAGCACCAGGAGAGG - Intergenic
1132552212 16:558231-558253 TGGGGGGTGAGGAGCATGTGAGG - Intergenic
1132739386 16:1403860-1403882 AGGGGGATGGGCAGAAGAGGCGG + Intronic
1132748632 16:1447302-1447324 TCGGGGAGGGGCAGCCGGGGGGG - Intronic
1132771671 16:1567034-1567056 AGGTGGATGAGCAGAAGGGCAGG - Intronic
1132871820 16:2118767-2118789 GGGCGGAGGAGCAGCAGGTGCGG - Exonic
1132909400 16:2300743-2300765 TGCGGGCAGAGCAGCAGGGAAGG + Intronic
1133114681 16:3570577-3570599 AGGGGGAGGAGGAGCAGAGGTGG + Intronic
1133233393 16:4376813-4376835 TGGGGGCTGGGGAGCGGGGGTGG - Intronic
1133358212 16:5152731-5152753 TGGAGGATGGACTGCAGGGGAGG + Intergenic
1133754961 16:8755567-8755589 TGGGAGATGACCTGCAGGGCAGG + Intronic
1134441284 16:14301201-14301223 AAGGGGATGAGCTGCTGGGGGGG + Intergenic
1134520708 16:14918129-14918151 GGGCGGAGGAGCAGCAGGTGCGG + Intronic
1134550867 16:15137845-15137867 GGGCGGAGGAGCAGCAGGTGCGG - Intronic
1134708380 16:16316780-16316802 GGGCGGAGGAGCAGCAGGTGCGG + Intergenic
1134715595 16:16356813-16356835 GGGCGGAGGAGCAGCAGGTGCGG + Intergenic
1134951222 16:18351865-18351887 GGGCGGAGGAGCAGCAGGTGCGG - Intergenic
1134959162 16:18395346-18395368 GGGCGGAGGAGCAGCAGGTGCGG - Intergenic
1135382219 16:22004693-22004715 TGGGGAAAGGGAAGCAGGGGTGG - Intergenic
1136173447 16:28502245-28502267 TGGGGGAAGAGCTACAGGGATGG - Intronic
1137718193 16:50611611-50611633 TGGGGGCTGAGCAGCACTCGGGG + Intronic
1137723702 16:50642770-50642792 TGGGGGCTCTGCAGCCGGGGTGG - Intergenic
1138454930 16:57115727-57115749 TGGGGGCTGACAAGCTGGGGAGG + Intronic
1138528784 16:57623642-57623664 TGGGGGATGGGCAGTGGGTGGGG + Intronic
1138736766 16:59259890-59259912 TGGGGGGTGGGCAGTGGGGGAGG + Intergenic
1139294434 16:65887878-65887900 TGGGAGATGAGGGACAGGGGTGG + Intergenic
1139485950 16:67256735-67256757 AGGGAGATGAGCTGCAGGGAGGG - Intronic
1139561252 16:67743805-67743827 TGGTGAATGAGCAGCAGCCGGGG - Intronic
1140491304 16:75338222-75338244 TGGGGAATGTGAAGCATGGGGGG + Intronic
1140772047 16:78214073-78214095 CAGGGCATGGGCAGCAGGGGAGG - Intronic
1141516710 16:84549623-84549645 TGGGGCTAGAGCAGCGGGGGTGG + Intronic
1141942529 16:87287013-87287035 TGGGGAAAGAGCAGGAGGGAAGG + Intronic
1142112563 16:88340116-88340138 TGGGGTAGGAGGAGAAGGGGTGG - Intergenic
1142342856 16:89535456-89535478 CGGGGGACAAGCAGCAGGAGAGG - Intronic
1142453899 16:90204489-90204511 TGTGGGGTGAGGAGTAGGGGAGG + Intergenic
1203141784 16_KI270728v1_random:1771701-1771723 TGGAGGAGGAGGAGGAGGGGCGG - Intergenic
1142485859 17:247331-247353 TGGGCAAGGAGCAGGAGGGGAGG - Intronic
1142591731 17:1009252-1009274 TGGGGGGTGGACAGCAGTGGGGG - Intronic
1142591737 17:1009269-1009291 TGGGGGGTGGACAGCAGTGGGGG - Intronic
1142641425 17:1288230-1288252 TGGGGGATGGGGAGCTGGTGGGG - Intronic
1142641440 17:1288266-1288288 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641466 17:1288321-1288343 TGGGGGATGAGGAGCCCGTGGGG - Intronic
1142641552 17:1288520-1288542 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641581 17:1288592-1288614 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641604 17:1288646-1288668 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641621 17:1288682-1288704 TGGGGGATGAGGAGCCCGTGGGG - Intronic
1142641672 17:1288791-1288813 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641697 17:1288845-1288867 TGGGGGATGAGGAGCCCGTGGGG - Intronic
1142641851 17:1289176-1289198 TGGGGGATGAGGAGCCGGAGGGG - Intronic
1142641874 17:1289230-1289252 TGGGGGATGAGGAGCCGGAGGGG - Intronic
1142641907 17:1289304-1289326 TGGGGGATGAGGAGCCTGTGGGG - Intronic
1142641951 17:1289413-1289435 TGGGGGATGAGGAGCCGGAGGGG - Intronic
1142641959 17:1289431-1289453 TGGGGGATGAGGAGCCCGTGGGG - Intronic
1142681617 17:1552978-1553000 TGCGGCATGAGCAGCGGGGCCGG - Intronic
1142759485 17:2034664-2034686 AGGGGGATGGGGAGCAGGGGAGG - Intronic
1143305362 17:5942136-5942158 TGCAGGAGGAGGAGCAGGGGAGG + Intronic
1143324592 17:6090550-6090572 TGGGGGATGGGCAGCCAGAGCGG - Intronic
1143521804 17:7448556-7448578 CTGGGGATGAGCAGAAGGAGGGG - Intronic
1144169933 17:12649787-12649809 TGGGGTATGTGCAGAAGGAGAGG + Intergenic
1144715614 17:17433566-17433588 TGGGGGAGGGGCAGCAGGTGGGG - Intergenic
1145875607 17:28316846-28316868 CAGGGGATGAACAGCATGGGTGG - Intergenic
1146149897 17:30458490-30458512 TGTGGGATGAGTGGGAGGGGCGG + Intronic
1146644440 17:34567774-34567796 TGGGGGAGGTGGTGCAGGGGAGG - Intergenic
1146790777 17:35749325-35749347 TGGGGAATGAGAAGCAAGGAGGG + Intronic
1146914054 17:36666801-36666823 TGGGAGACGTGCAGCAGGGTGGG + Intergenic
1146944378 17:36863956-36863978 TGGGGGGAGAGGGGCAGGGGAGG - Intergenic
1147122314 17:38343106-38343128 TGGGGGACACGCAGCAGGTGAGG - Exonic
1147159923 17:38563772-38563794 TGGGGGCAGAGCAGGTGGGGCGG + Intronic
1147453507 17:40520516-40520538 TGGGGGGTGAGGGTCAGGGGAGG + Intergenic
1147552469 17:41453861-41453883 AGGAGAATGAGAAGCAGGGGTGG - Intergenic
1147612448 17:41810053-41810075 TGGTGGTTGAGTGGCAGGGGTGG - Intronic
1147972996 17:44229801-44229823 TTGGGGGTGAGCAGTTGGGGTGG + Intergenic
1147975731 17:44247235-44247257 TGGAGCTTGGGCAGCAGGGGAGG - Intergenic
1148027797 17:44600400-44600422 TGGGGCATCAGCAGCAAGGAGGG - Intergenic
1148107839 17:45128645-45128667 GGGAGGATGAGGGGCAGGGGCGG + Intronic
1148334091 17:46830141-46830163 TGGGTGATGAGGATGAGGGGAGG - Intronic
1148672827 17:49424878-49424900 CGGGGGATTAGGAGTAGGGGTGG + Intronic
1148794403 17:50190165-50190187 TGGGGGAGGAGCAGTAATGGAGG + Intronic
1148807619 17:50272233-50272255 TGGGGGGTCAGCAGGAGTGGGGG - Intronic
1148837728 17:50474761-50474783 TGGGGGATGGACAGGAGGGAGGG - Exonic
1148910991 17:50942664-50942686 TGGGTGAGGAGCAGCTGCGGTGG + Intergenic
1149890660 17:60386753-60386775 TGGGGGATGAGCAAAATGAGGGG - Intronic
1150764762 17:67994019-67994041 TGGGGGAGGAGAAGCAGTGAGGG + Intergenic
1151317881 17:73335104-73335126 TGAGGGATGGACAGAAGGGGAGG + Exonic
1151770409 17:76156780-76156802 TGTGGGAGGAGCAGCAGGCTGGG - Intronic
1152095883 17:78271423-78271445 TGGAGGATGAGCAGGAGGTGGGG + Intergenic
1152134064 17:78493857-78493879 TGGGGGCCGAGGAGGAGGGGAGG - Intronic
1152141847 17:78541160-78541182 GGGGGGATGAGCAGATGGGTGGG + Intronic
1152269918 17:79318347-79318369 TGGGGGCAGAGGAGCTGGGGAGG + Intronic
1152281696 17:79388747-79388769 CGGGGCATGTGCAGGAGGGGTGG - Intronic
1152472793 17:80499752-80499774 TGGGTGAGGAGCAGCAAAGGCGG + Intergenic
1152687303 17:81700911-81700933 AGGGGGAGGAGCAGAAGGGGTGG - Intronic
1152701444 17:81821851-81821873 CCGGGGAGGAGGAGCAGGGGAGG - Intergenic
1153087341 18:1303248-1303270 TGGGGGATTAAAAGCAGGGGTGG - Intergenic
1154031224 18:10755984-10756006 TGGAGGATGAGGAGGAGGGATGG + Intronic
1154031259 18:10756122-10756144 TGGAGGATGAGGAGGAGGGATGG + Intronic
1154031316 18:10756426-10756448 TGGAAGATGAGGAGGAGGGGTGG + Intronic
1154031351 18:10756623-10756645 TGGAGGATGAGGAGGAGGGGTGG + Intronic
1154031468 18:10757188-10757210 TAGAGGATGAGGAGGAGGGGTGG + Intronic
1154496131 18:14962851-14962873 GGGTGGAGGAGCAGCAGGGAGGG + Intergenic
1156187656 18:34681967-34681989 TGAGGGGTGAGGTGCAGGGGAGG - Intronic
1156743833 18:40365587-40365609 TGGGGAATGAGGAGCAGATGGGG - Intergenic
1157175367 18:45446932-45446954 GTGGGGATGAGAAGCAGGGTGGG - Intronic
1157851512 18:51057002-51057024 TGGGGGATGAGTAGGAAGGGAGG + Intronic
1157856255 18:51108237-51108259 TGGAGGATCAGCAGCAGGAAAGG + Intergenic
1158555512 18:58471518-58471540 TGGAGGAGGAGCAGCAGGCTGGG - Intergenic
1158566345 18:58557152-58557174 TGGGGGCTGCCCAGCAGGGCTGG + Intronic
1159877221 18:73826626-73826648 GGAAGGCTGAGCAGCAGGGGAGG + Intergenic
1160123658 18:76151606-76151628 TGGGTGCTGAGCAGAAGGAGTGG - Intergenic
1160923009 19:1529382-1529404 TGAGGTGGGAGCAGCAGGGGTGG - Intronic
1160927663 19:1554628-1554650 TGGGGGATGGGCACCAGGAGGGG - Intergenic
1161004905 19:1930225-1930247 TGGGGGATGGGCTGCAGAGAGGG - Intergenic
1161557800 19:4954414-4954436 AGGAGGAGGAGCAGCAGGAGGGG + Exonic
1161585650 19:5103995-5104017 TGGGTGAGGAGCAGAAGGAGGGG + Intronic
1162129567 19:8517704-8517726 GTGGGGGTGAGCAGCAGGCGGGG + Intergenic
1162767752 19:12930309-12930331 TGGAGGATGAGGTGCAGCGGCGG - Exonic
1162784184 19:13023921-13023943 GGGAGGAGGAGGAGCAGGGGAGG - Intronic
1162828567 19:13269799-13269821 TGGGTGAGGTGCAGGAGGGGTGG + Intronic
1163003761 19:14384590-14384612 TGGGATATGAGCGGCAGGTGGGG - Intronic
1163169011 19:15517828-15517850 TGGAGGATGAGGAGCTGGTGTGG + Intronic
1163476204 19:17527390-17527412 TAAGGGGTGAGCAGCCGGGGAGG + Exonic
1163499569 19:17668225-17668247 TGGAGGCTGAGCGGCAGGGAGGG - Intronic
1164402025 19:27909459-27909481 TGTGGGGAGAGCAGCAGGTGAGG - Intergenic
1164574854 19:29399926-29399948 AGGGGAAAGAGCAGCAGGAGGGG + Intergenic
1164746695 19:30621683-30621705 TGGGTGAGGAGCAGCCGGGTGGG + Intronic
1165108757 19:33489109-33489131 TGAGGGGTGACAAGCAGGGGAGG + Intronic
1166225202 19:41390790-41390812 TGGAGGATCAGCAGCAGAGCTGG - Intronic
1166783149 19:45352659-45352681 CGGAGGATGAGAAGCTGGGGAGG + Intronic
1166854529 19:45776984-45777006 GGAGGGATGAGAAGCAGGAGAGG - Intronic
1166889093 19:45979402-45979424 TGGGGAAAATGCAGCAGGGGAGG + Intergenic
1167461381 19:49626230-49626252 TGGGGGATGGGCAGTGGGTGGGG - Exonic
1167655210 19:50759243-50759265 TGGAGGATGAGCAGCATCTGGGG - Intergenic
1167657012 19:50771474-50771496 TGGAGGATGAGCAGCATCCGGGG - Exonic
1167741358 19:51326606-51326628 TGGGGGAGGGGCTGCAGGGCCGG - Intronic
1167964356 19:53131653-53131675 ACGGGGAGGAGCAGCAGGAGAGG - Intronic
1168337961 19:55606999-55607021 GAGTGGAGGAGCAGCAGGGGAGG + Intronic
1168510405 19:56969049-56969071 CGGGGGAAGAGCACAAGGGGTGG - Intergenic
1202704558 1_KI270713v1_random:13524-13546 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
924977901 2:194901-194923 TGGGGAAGGACCAGCATGGGTGG - Intergenic
925068785 2:950664-950686 TGGGGGAAGTGCAGGATGGGGGG - Intergenic
925169737 2:1743629-1743651 TGGGGGAGGAGAAGGAAGGGGGG + Intronic
925235043 2:2270750-2270772 TGGGGCAGGAGCACCAGGGCAGG - Intronic
925601982 2:5617450-5617472 TGGCAGTTGAGCAGCAGGGCTGG + Intergenic
926393447 2:12417810-12417832 TGGGGGAGGGGCAGGAGGGAGGG - Intergenic
927209611 2:20630953-20630975 TGAGAGAGGAGCAGCAGAGGGGG + Intronic
928094920 2:28398609-28398631 AGGGGGAAGAGAAGCAGGGAAGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928456389 2:31426554-31426576 TGAAGGAAGAGCAGCAGAGGAGG + Intergenic
929582109 2:43087948-43087970 GGAGGGGTGAGCAGCAGGTGAGG + Intergenic
929992172 2:46799615-46799637 GTGGGGATGAGGAGTAGGGGTGG - Intergenic
929997630 2:46838760-46838782 CAGGGGATGAGCAGAAGGGGAGG + Intronic
931212892 2:60214263-60214285 AGGGAGATGAGGATCAGGGGAGG + Intergenic
931766235 2:65459060-65459082 TGGGAAATGAGGAGGAGGGGAGG - Intergenic
932250898 2:70242714-70242736 CAGGAGGTGAGCAGCAGGGGAGG + Intronic
933220309 2:79680020-79680042 AGGGGGATGAGCAGCAAGAGAGG + Intronic
933269523 2:80218092-80218114 TTGGGGATGAGCTGAAAGGGTGG + Intronic
933709427 2:85314776-85314798 TGGGGGCTGAGGACCAGGGCTGG + Intergenic
933840517 2:86282558-86282580 AGGGGGGTTAGCAGCAGGAGAGG - Intronic
933860487 2:86461900-86461922 GGGGGGAGGAGGAGCAGGAGTGG + Intronic
934553409 2:95275547-95275569 TCTGGGGTGAGCAGCAGGGTGGG + Intronic
934760468 2:96852961-96852983 TGAGGGATGAGGAGCTGGGTGGG + Intronic
935172672 2:100622684-100622706 TGGAGCATGAGCAAGAGGGGTGG - Intergenic
935952997 2:108347994-108348016 TGGGGGAGGGGCAGGAGGCGAGG - Intergenic
936403629 2:112184183-112184205 TGGGGGAAGTCCAGCTGGGGAGG - Intronic
936519196 2:113201228-113201250 TGTGGGAGGAGCAGCTGGGGAGG + Exonic
937066743 2:119023433-119023455 GGGGGCATGAGGAGCAGGAGTGG + Intergenic
937198288 2:120179882-120179904 TGGAGGATGGGCAGCAGTGGAGG + Intergenic
937273352 2:120669318-120669340 TGGGGGAGAAGCAGGAGGCGGGG + Intergenic
937295942 2:120810033-120810055 AGGTGGATGAGCCCCAGGGGCGG + Intronic
937312213 2:120909331-120909353 TGAGGGAAGGGCAGCAGGGGAGG - Intronic
938795986 2:134718777-134718799 TGGAGGAGGAGCGGCAGGTGCGG - Exonic
939586470 2:144012128-144012150 GAGGGGATGGGCAGCAGGAGAGG - Intronic
939954419 2:148514630-148514652 TGGGAGAGGAGCAGTAGGAGAGG - Intronic
940043830 2:149388616-149388638 AGGGGGATGAGGAGCTGGGAAGG + Intronic
940324768 2:152413518-152413540 TGGGGGAGGAGGAGAAGGTGGGG + Intronic
940954445 2:159712464-159712486 GGGGGGAGGAGGAGCAGGGAGGG + Intronic
941154157 2:161955009-161955031 TGTGAGATGAGCATCAGAGGAGG - Intronic
942367334 2:175241324-175241346 AGGGAGCTGAGAAGCAGGGGAGG - Intergenic
942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG + Intronic
946155410 2:217803725-217803747 TGGTGGCAGTGCAGCAGGGGAGG - Exonic
946188719 2:217996076-217996098 TGGGGGCAGAGCAGCAGTGAGGG + Intronic
946446609 2:219745565-219745587 TGGGGCTTGAGCAGCAGGAAGGG + Intergenic
946993641 2:225365164-225365186 TGGGGGAGGAGAAGCAGCAGGGG - Intergenic
947227161 2:227851618-227851640 TGGGGGATGCACAGCAGATGGGG + Intergenic
947337519 2:229102833-229102855 TGGGTGATGAGCCGCATGGCAGG - Intronic
947751636 2:232535639-232535661 TGGGGGAGGAGAAGCAGAGAAGG - Exonic
948079142 2:235191383-235191405 TGGGAGAGGAGCAGCTGGGAGGG - Intergenic
948313111 2:237004528-237004550 TGGGGGAAGAACATCAAGGGTGG + Intergenic
948588256 2:239034801-239034823 TGGGGGGTGGGGAGCAGGGCAGG - Intergenic
948805244 2:240451114-240451136 TGGGGAAGGAACAGAAGGGGAGG - Intronic
949047256 2:241877732-241877754 TGGGGAGTGAGGAGCATGGGGGG - Intergenic
1168790876 20:574838-574860 TGGGGGGAGGGCAGGAGGGGTGG + Intergenic
1169028711 20:2391505-2391527 TGGGGGGTGAGCTGGAGGAGTGG + Intronic
1169072046 20:2738690-2738712 TGGGGCCTGAGGAGAAGGGGAGG - Intronic
1169136323 20:3199995-3200017 TGGAGGAGGAGCAGAAGGTGAGG - Exonic
1169195581 20:3680640-3680662 TGGGGGAGGGGAAGGAGGGGAGG + Intronic
1169432316 20:5548856-5548878 AGGGGGATTAGGAGTAGGGGTGG - Intronic
1169441068 20:5634385-5634407 TGGGGGAAAAGAAGCAGAGGTGG - Intergenic
1169970787 20:11267541-11267563 TGAAGGCTGAACAGCAGGGGTGG + Intergenic
1170568636 20:17620754-17620776 TGGAGGAGGAGGAGCAGGTGTGG - Exonic
1170683458 20:18547501-18547523 TCGAGGATGAGAAGAAGGGGTGG - Intronic
1171181568 20:23094712-23094734 GGGGGGACCAGCAGGAGGGGAGG + Intergenic
1172122745 20:32608298-32608320 TGGGGGCAGATCTGCAGGGGAGG - Exonic
1172272462 20:33662479-33662501 CGGGGGATGGGGAGCAGGGCTGG + Intronic
1172428409 20:34871848-34871870 AGGAGGAAGAGCAGCAGGGAAGG + Intronic
1172787022 20:37475173-37475195 TGGGGGAAGAGAAGCAGAGGAGG - Intergenic
1173469876 20:43314772-43314794 TGTGGGATGGGGAGCAGTGGTGG - Intergenic
1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG + Intronic
1173853315 20:46232752-46232774 TGGGAGGAGGGCAGCAGGGGTGG - Intronic
1173917088 20:46715616-46715638 AGAGGGATGAGCAGAAGTGGGGG + Intronic
1173990972 20:47303184-47303206 TGGGTGAGGAGCAGCAGGAAGGG + Intronic
1174369317 20:50075796-50075818 TGGGGGAAGTGCATGAGGGGAGG + Intergenic
1174391094 20:50218843-50218865 TGGAGGCTGTGGAGCAGGGGAGG - Intergenic
1175058262 20:56218014-56218036 TTGTTGAAGAGCAGCAGGGGAGG - Intergenic
1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG + Intronic
1176036019 20:63036990-63037012 TGTGGGAGGAGCGGGAGGGGAGG + Intergenic
1176424314 21:6538530-6538552 TGGGGGATGGGGAACGGGGGCGG + Intergenic
1176801629 21:13435985-13436007 GGGAGGAAGAGAAGCAGGGGAGG - Intergenic
1177224625 21:18238001-18238023 TGGGGGAGGATAAGCAGAGGTGG + Intronic
1178356493 21:31913784-31913806 TGGGGGAGAAGCAGGAGGTGTGG + Intronic
1178744771 21:35238250-35238272 AAGGGCATGAACAGCAGGGGTGG + Intronic
1179222287 21:39419138-39419160 TGGGGGGTGAGGAGTTGGGGCGG - Intronic
1179602595 21:42490117-42490139 TGGGGGATGAGATGGAGGGGAGG - Intronic
1179699807 21:43146845-43146867 TGGGGGATGGGGAACGGGGGCGG + Intergenic
1180018127 21:45100869-45100891 TGGGGTATGGGCCGCAGGCGTGG + Intronic
1180176466 21:46092855-46092877 TGGGAGGGGAGCAGCATGGGTGG - Intergenic
1181051781 22:20241365-20241387 TGGGCGGTGAGAAGCAGGGGTGG - Intergenic
1181168569 22:20995878-20995900 TGGGGGCTGGACAGGAGGGGAGG + Intronic
1181275870 22:21687218-21687240 TGTGGGCAGAGCAGCAGGTGCGG - Intronic
1181753352 22:25005471-25005493 TGGGGGTTGAGGGGCAGTGGTGG + Intronic
1182482310 22:30617099-30617121 TGGGGAATGAGGGACAGGGGAGG + Intronic
1182482326 22:30617142-30617164 TGGGGAATGAGGGACAGGGGAGG + Intronic
1182689711 22:32150540-32150562 TGGGGGATGTGGACCAGGGCTGG + Intronic
1182712577 22:32332015-32332037 TGGGGGCTGAGAAGGAGGTGGGG - Intergenic
1182865765 22:33602942-33602964 TGGGGGAAAAGCAACATGGGAGG - Intronic
1182991524 22:34772235-34772257 TGATTGATGAGGAGCAGGGGTGG - Intergenic
1183108353 22:35630336-35630358 GGGGGGAGGAGGAGGAGGGGAGG + Intronic
1183186400 22:36293899-36293921 TGGGGCAGGAGCAGTGGGGGTGG - Intronic
1183192018 22:36327706-36327728 TGGGGGCTGAACAGCGTGGGTGG - Intronic
1183379877 22:37485535-37485557 TGGGTGTTGGGCAGCTGGGGTGG - Intronic
1183404659 22:37624564-37624586 TGGAGGAAGAGAAGCAGGGAAGG + Intronic
1183422070 22:37717872-37717894 TGGGCGCTGTGGAGCAGGGGCGG + Intronic
1183519579 22:38288961-38288983 ATGGGGCAGAGCAGCAGGGGCGG + Intergenic
1183596815 22:38817894-38817916 TGGGGCAGGTGCTGCAGGGGTGG + Intergenic
1183631574 22:39036202-39036224 AGGGGCATGAGCAGAAGGGAGGG - Intergenic
1183636109 22:39063800-39063822 AGGGGCATGAGCAGGAGGGAGGG - Intronic
1184377740 22:44125068-44125090 GGGGGGATGAGGTGCTGGGGAGG + Intronic
1184399821 22:44267397-44267419 TGGGGGCTGAGAAGGAGGTGGGG - Intronic
1184421392 22:44384720-44384742 TGGGAGATGAGCTGCCGGAGAGG + Intergenic
1184551023 22:45204172-45204194 CAGGGGCTGAGCAGCAGGGGAGG + Intronic
1184985138 22:48127191-48127213 TGGGGGGTGGGGGGCAGGGGAGG - Intergenic
1185044701 22:48523141-48523163 TGTGGCACGAGCGGCAGGGGAGG - Intronic
1185065569 22:48630156-48630178 CGGGGGATGAGCAGGTGGAGTGG + Intronic
1185199384 22:49492220-49492242 TGGAGGAAGAGCAGCTGGGGAGG - Intronic
1185233186 22:49694876-49694898 AGGGCGATGGTCAGCAGGGGTGG + Intergenic
1185368036 22:50445897-50445919 TGGGAGGCGAGCAGCAGGTGTGG - Exonic
949876812 3:8631646-8631668 TGGGGGCTCAGCAGAAGGTGGGG + Intronic
950419981 3:12892828-12892850 TGGGGGTTGCACAGCAGGAGAGG - Intergenic
950466938 3:13161292-13161314 TGCGGGAGGAGAAGCGGGGGAGG + Intergenic
950778684 3:15372798-15372820 TGGGGCGAGGGCAGCAGGGGTGG - Intergenic
951031340 3:17885206-17885228 TGGGGGATGGGGAGAAAGGGAGG - Intronic
952165649 3:30745957-30745979 AGGAGGAGGAGCAGGAGGGGTGG - Intronic
952382511 3:32816533-32816555 TGGGGGAGGGGAGGCAGGGGAGG - Intergenic
953279509 3:41540201-41540223 TGGGGGATGGGGAATAGGGGAGG - Intronic
953434153 3:42865408-42865430 TGGGGGAAAAGCAGCAGTGAAGG - Exonic
953620463 3:44528408-44528430 TGGTGGGTGAGCAGCAGGGATGG - Intergenic
954067495 3:48118464-48118486 GGGGGGCAGAGCAGCAGGGGAGG + Intergenic
954690195 3:52391650-52391672 TGGGAGAGGAGCAGCTGGGCAGG - Intronic
955182121 3:56682647-56682669 AGGGGGTTGAGAAGAAGGGGAGG + Intronic
956009520 3:64816003-64816025 TGCGGGATGAGGAGCAGAGATGG - Intergenic
956681376 3:71784985-71785007 CGGGGCGTGAGCAGCAGCGGCGG + Exonic
956900229 3:73707848-73707870 CTAGGGAAGAGCAGCAGGGGAGG - Intergenic
957062733 3:75495320-75495342 TGGAGGATGAACTGCAGGGGAGG + Intergenic
958816644 3:98923919-98923941 TGGGGCATGAGGAGAAGGGGAGG - Intergenic
959155770 3:102664420-102664442 TGTGGGACCTGCAGCAGGGGTGG - Intergenic
959768897 3:110069040-110069062 GAGGGGATGAGCAACAGCGGCGG + Intergenic
959827186 3:110812405-110812427 TTGGAGATGAGGAGCAGGGAGGG - Intergenic
959930139 3:111971641-111971663 TTGTGTATGAGAAGCAGGGGTGG - Intronic
959991631 3:112638325-112638347 TGGAGGACGAGCTGCAGGTGGGG - Exonic
960174740 3:114503717-114503739 TGGGGGATGAGCAGAGAGAGGGG + Intronic
960988841 3:123297436-123297458 TGGGGGCTGAGCAGGAGTGGAGG - Intronic
961290665 3:125844097-125844119 TGGAGGATGAACTGCAGGGGAGG - Intergenic
961755110 3:129122433-129122455 TGGGGGGCGAGCAGGAGGCGCGG - Intronic
961812782 3:129531372-129531394 TTGGGCCTCAGCAGCAGGGGAGG + Intronic
962040308 3:131700360-131700382 TGGGGGATGGGGTGCAGGGAGGG + Intronic
962745426 3:138394412-138394434 TGGGGGATGTGCAGCAATGAAGG + Intronic
962919205 3:139935699-139935721 CGGGGGCTGAGCAGAAGGCGAGG + Intronic
963000855 3:140680291-140680313 GTGGTGATGAGAAGCAGGGGAGG - Intronic
963838414 3:150080132-150080154 TGGGGGATGAGCAGCCGGAAGGG - Intergenic
963964235 3:151347684-151347706 TGGGGGATGTGCAGAGGAGGAGG + Intronic
964084828 3:152803720-152803742 TGGGGGAAGAACAGCAGGTAAGG + Intergenic
965304725 3:167050152-167050174 TGGGTGGTGGGCAGCAAGGGCGG - Intergenic
966220647 3:177547835-177547857 TGGGGGCAGAGGAGCAGAGGAGG - Intergenic
966876740 3:184326581-184326603 TGGGGCAAGGGCAGCAGCGGAGG + Exonic
966932989 3:184687661-184687683 TGGGGAATGGGGAGGAGGGGAGG + Intergenic
967387366 3:188924827-188924849 TGGGGAGTGGGCAGCAGTGGGGG + Intergenic
968359912 3:198139632-198139654 AGGGGGATGAGGAGGAGGAGAGG + Intergenic
968494291 4:906914-906936 TGGGAGGTGAGCAGAAGGGGCGG - Intronic
968573706 4:1355291-1355313 TGGGGGAGGAGAAGCTGTGGGGG + Intronic
968614892 4:1573326-1573348 TGGGGGAGAAGCTGAAGGGGTGG - Intergenic
968660868 4:1798222-1798244 TGGGGGCTGAGAAGCTGGGGTGG - Intronic
968741353 4:2333198-2333220 TCAGGGAAGGGCAGCAGGGGAGG - Intronic
968741361 4:2333221-2333243 TCAGGGAAGGGCAGCAGGGGGGG - Intronic
968818363 4:2833202-2833224 GGGAGGCTGAGCAGGAGGGGTGG - Intronic
968917689 4:3503990-3504012 AGGGGGCTGACCAGCAGGGTGGG + Intergenic
968941303 4:3640216-3640238 TGGGGGATGAGGAGTACAGGAGG + Intergenic
968965672 4:3768032-3768054 TCGGGGCTGGGCAGAAGGGGCGG + Exonic
969153374 4:5189089-5189111 TGGGGGAAGTGCTGCATGGGTGG - Intronic
969208911 4:5671379-5671401 TGAGGGAGTAGCAGCAGGGCAGG + Intronic
969347117 4:6576447-6576469 TGGGGGGTGAGCAGCAGGGAAGG + Intronic
969430851 4:7153483-7153505 TGGGGAAGGAGGAGCAAGGGAGG - Intergenic
969449898 4:7266976-7266998 TGGGGGAGGTGTGGCAGGGGAGG + Intronic
969680028 4:8637746-8637768 TGGGGTATGAGCAGAAGTGATGG - Intergenic
969696873 4:8740002-8740024 TGGGGCATGGGCAACACGGGTGG + Intergenic
969726123 4:8919527-8919549 TGGGGGGTGGGCAGCAGGCCGGG - Intergenic
969806344 4:9611959-9611981 TGGAGGATGAACTGCAGGGAGGG - Intergenic
970350515 4:15197268-15197290 TGGGAGATGGGCAGCTGGGGAGG + Intergenic
970654383 4:18214931-18214953 TGGGAGATCAGCAGGAGGGCAGG + Intergenic
971126472 4:23760631-23760653 TGGGGGCTGTGCCACAGGGGAGG - Intronic
971362471 4:25950715-25950737 TGGGAAATCAGCAGCAGGGATGG - Intergenic
971422850 4:26489913-26489935 TGGGGGAACAAAAGCAGGGGAGG - Intronic
973368769 4:49228779-49228801 TTGGGGATGAAAGGCAGGGGTGG - Intergenic
973613504 4:52658760-52658782 TGGGGGATAAGCTGGAGGTGGGG - Intronic
977597734 4:98901956-98901978 CGGGGGATTAGGAGTAGGGGTGG + Exonic
979209044 4:118077755-118077777 TTGGCGATGAGCAGCAGGAGTGG + Intronic
979251940 4:118574839-118574861 AGGGGAAAGAGCAGCAGGAGGGG - Intergenic
979262783 4:118667400-118667422 TGTGGGGTGAGGAGTAGGGGAGG + Intergenic
979787114 4:124730162-124730184 TGAGGGATGAGCAGGAGTGCAGG - Intergenic
980113711 4:128659025-128659047 TGGGGGGTGGGGAGCGGGGGTGG + Intergenic
982350296 4:154407952-154407974 GGTGGGAGGAGCAGCAGGGAGGG - Intronic
982360980 4:154518731-154518753 TGAGGGAAGAGCAGGAGGGCTGG + Intergenic
983389970 4:167117642-167117664 TGGGGGCAGAGCAGCAGGGTGGG + Intronic
985307072 4:188555074-188555096 TGAGGGCTGAGCAGCAGCAGTGG - Intergenic
985716994 5:1468220-1468242 TGTGGGATGAGGCCCAGGGGAGG - Intronic
985988695 5:3538137-3538159 TGGGGCATGGGCTGCAGGGGAGG - Intergenic
986170494 5:5310718-5310740 TAAGGTATGAGCAGCAGAGGTGG - Intronic
986536519 5:8793729-8793751 TGGAGGATGAGCTGGAGGGGTGG - Intergenic
986583927 5:9294865-9294887 TGGTGGAAGAGAAGGAGGGGAGG - Intronic
986667514 5:10116274-10116296 AGGAGGAGGAGAAGCAGGGGTGG + Intergenic
987244717 5:16037256-16037278 TGTCAGGTGAGCAGCAGGGGAGG - Intergenic
987602911 5:20095153-20095175 CGGGGGATGAGGGGCAAGGGAGG + Intronic
988529309 5:32013785-32013807 TGGGGGTGGAGCAGAAGGGGAGG - Intronic
989123248 5:38025846-38025868 TGGGGGAGCCACAGCAGGGGAGG + Intergenic
989552351 5:42750639-42750661 CGGGAGGTGAGCAGCAGGTGAGG + Intergenic
990322915 5:54647561-54647583 TGGGGCATGAGAGGAAGGGGAGG + Intergenic
990410353 5:55535081-55535103 CGGGGGGAGTGCAGCAGGGGCGG + Intergenic
991062323 5:62390576-62390598 TGGGGAAGGAGCAGGAAGGGAGG + Intronic
991126307 5:63073452-63073474 TGGGAGGTGAGCAGGAAGGGAGG - Intergenic
991471977 5:66978651-66978673 CTGGGGATGAGCAGAAGGGTAGG + Intronic
991977610 5:72198547-72198569 AGGGGTATGAGCAGAAGAGGTGG - Exonic
992518287 5:77520632-77520654 GGGTGGATGAGCAGCTGAGGAGG - Intronic
993502410 5:88678518-88678540 TGGGGGAGGCGCAGAAGGGAGGG - Intergenic
994963426 5:106635155-106635177 AGTGGGAGGGGCAGCAGGGGAGG + Intergenic
996673507 5:126148335-126148357 AGGAGGATGAGGAGGAGGGGGGG - Intergenic
997213835 5:132094542-132094564 TGGGGAATGCTCAGAAGGGGAGG - Intergenic
997379058 5:133422182-133422204 TGGGGACAGAGCAGCAGGGCTGG + Intronic
997854841 5:137364044-137364066 GGGGAAATGAGCAGCAGGGCTGG - Intronic
998821224 5:146059826-146059848 AGAGAGATCAGCAGCAGGGGCGG - Intronic
998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG + Intronic
999270902 5:150295835-150295857 TTGTGGATGAGCAGGATGGGTGG - Intergenic
999328969 5:150660116-150660138 AAGGGGAGGAGCAGGAGGGGTGG - Intergenic
999450105 5:151671590-151671612 TGGGGGCTGGGCAGCTGGTGGGG + Exonic
999715253 5:154355231-154355253 GGGGGGAGGAGCAGGAAGGGAGG - Intronic
1001098448 5:168794531-168794553 TGAGGGAGGAACAGCAGGGTTGG + Intronic
1001617730 5:173056524-173056546 TGGGGGAAGAGCGGAACGGGGGG + Intronic
1002639722 5:180625043-180625065 TGGGGGAGGCTCAGTAGGGGTGG - Intronic
1002737488 5:181406035-181406057 TGTGGGGTGAGGAGTAGGGGAGG + Intergenic
1002866714 6:1128187-1128209 TGGGGTAGGAGGAGCAGGGAGGG + Intergenic
1003255915 6:4474821-4474843 TTGGGGATGAGGAGGAGAGGTGG - Intergenic
1003934488 6:10961130-10961152 TTGGGGATGAGCAGGCAGGGAGG + Intronic
1004032150 6:11881205-11881227 AGGGAGAAGAGCAGCAGAGGAGG + Intergenic
1004064255 6:12227488-12227510 TGGGGGATGAGGGGCAGGGAAGG + Intergenic
1004370942 6:15051559-15051581 TGGTGCATCAGCAGGAGGGGAGG - Intergenic
1004429354 6:15529903-15529925 GGAGGGCTGAGCAGCAGAGGGGG - Intronic
1005842399 6:29752384-29752406 TGGGGGATGGGCAGCCAGGCCGG - Intergenic
1005856398 6:29866397-29866419 TGCGGGAGGAGGAGCAGGGGTGG - Intergenic
1005862232 6:29910727-29910749 TGAGGGAGGAGGAGCAGGGGTGG - Intergenic
1006130244 6:31864782-31864804 TGGGGGTGGAGCAGCAGAGAGGG + Intronic
1006410637 6:33871342-33871364 TGGGCGGTGAGAAGCAGGCGGGG - Intergenic
1006437798 6:34035267-34035289 TGGGGTAAGGGCAGCAGGGATGG + Intronic
1006934786 6:37709872-37709894 TGGGGGAAGTGAAACAGGGGAGG - Intergenic
1006984223 6:38166778-38166800 TGGGGGGTGAGCAGGGGCGGTGG - Intergenic
1007134236 6:39506356-39506378 TGGGGGTTGGGCACGAGGGGAGG + Intronic
1007214663 6:40227933-40227955 TGGGGGAGGTGCAGTGGGGGAGG + Intergenic
1007705387 6:43787629-43787651 TCAGGGATGAGCAGCAGCCGAGG + Intergenic
1009380366 6:63020532-63020554 TGAGGGATGATCAGCAGCAGGGG + Intergenic
1009623897 6:66111300-66111322 TGGGGGATGAGAGGCCAGGGAGG - Intergenic
1010414891 6:75601865-75601887 TGGGGGAGGAGCGGCAGCGGCGG + Intronic
1010569696 6:77462724-77462746 AGGGCGATGAGGAGCAGGGTGGG + Exonic
1011027500 6:82885364-82885386 TAGGGGATGACAAGGAGGGGTGG + Intergenic
1011252517 6:85387754-85387776 TGGGGGATGGGAAGGAGGTGAGG + Intergenic
1013179938 6:107709031-107709053 TGGGGCTGGGGCAGCAGGGGTGG - Intronic
1013275543 6:108581320-108581342 TGGGGGTTGAGGAGCATGGAAGG + Intronic
1013666470 6:112354594-112354616 TTGGGGATGAGGAGGAGGTGAGG - Intergenic
1014547944 6:122754584-122754606 GGGGGGATGGGGAGCATGGGAGG - Intergenic
1014989886 6:128061547-128061569 TGGGGGTTGGGAGGCAGGGGAGG + Intronic
1015373822 6:132487475-132487497 CAGGGGATGAGGGGCAGGGGAGG + Intronic
1015940906 6:138450985-138451007 TGGAAGAGGAGGAGCAGGGGAGG - Intronic
1015999443 6:139028723-139028745 TGGAGGAGGAGGAGCAGGGTAGG - Exonic
1016386648 6:143536697-143536719 TGGGGGAGGAGCAGCCGGGCAGG + Intergenic
1017352845 6:153463400-153463422 TGGGGGAAGAGGGGCAGGGGAGG + Intergenic
1018041755 6:159930545-159930567 TGGAGGCACAGCAGCAGGGGTGG - Intergenic
1018144609 6:160872740-160872762 TGGGGGAAGTGGGGCAGGGGAGG - Intergenic
1018430461 6:163717643-163717665 TGGAGGCAGAGAAGCAGGGGTGG + Intergenic
1018899471 6:168043963-168043985 TGGGCCGTGAGCAGCAGGTGTGG + Intronic
1019242585 6:170681590-170681612 TGTGGGGTGAGGAGTAGGGGAGG + Intergenic
1019432693 7:1006845-1006867 TGGGAGCTGTGCAGCAGGGCTGG - Intronic
1019521310 7:1461682-1461704 TGGAGGATGAGGAGGAGGGGCGG - Intergenic
1020079949 7:5281974-5281996 TGAGGGGTGGGCAGCGGGGGTGG + Intronic
1020141703 7:5615321-5615343 ATGAGGATGAGCAGCAGGCGGGG + Intergenic
1020376288 7:7491134-7491156 TGGGGGTTTATCAGCAGGGAAGG - Intronic
1021202427 7:17741627-17741649 CTGGCGAGGAGCAGCAGGGGTGG - Intergenic
1021277070 7:18664625-18664647 TGAGGGGTGGGAAGCAGGGGCGG - Intronic
1021469175 7:20981666-20981688 ATGGGGATGAGAAGAAGGGGAGG - Intergenic
1022374742 7:29802843-29802865 TGGGGGATGGGCAACAGAGTGGG + Intergenic
1022794696 7:33722679-33722701 TGGGGATTGAGCTGCAGGCGAGG - Intergenic
1024523801 7:50330870-50330892 TGCAGGGTGAGCAGCAGGGGCGG + Intronic
1024999554 7:55303675-55303697 AGGAGGAGGAGGAGCAGGGGAGG + Intergenic
1025198964 7:56950242-56950264 TGAGGGGTGGGCAGCGGGGGTGG - Intergenic
1025264074 7:57441047-57441069 TGAGGGCTGAGAAGCTGGGGTGG - Intergenic
1025605833 7:63039280-63039302 TCCAGGATGAGCAGCAGAGGTGG - Intergenic
1025635157 7:63315055-63315077 TGAGGGCTGAGAAGCTGGGGTGG + Intergenic
1025647538 7:63433115-63433137 TGAGGGCTGAGAAGCTGGGGTGG - Intergenic
1025672982 7:63626691-63626713 TGAGGGGTGGGCAGCGGGGGTGG + Intergenic
1025850477 7:65239701-65239723 TGTGTGGTGAGCAGCAGGCGGGG - Intergenic
1026841277 7:73671168-73671190 GGGGGGATCAGCAGCCGAGGTGG - Exonic
1027816719 7:82982313-82982335 TGGGGGATGAGACTCAGGGAAGG + Intronic
1028159976 7:87474935-87474957 CAGGGGATGGGCAGGAGGGGAGG + Intronic
1029123092 7:98281432-98281454 TGGGGGATGGGCGGGGGGGGGGG + Intronic
1029270712 7:99375161-99375183 TGGGGGCCGGGGAGCAGGGGCGG - Intronic
1029507528 7:100971383-100971405 TGTGGGGTGGGCAGAAGGGGTGG + Intronic
1031531848 7:122886092-122886114 TGGACGATGAGCAGGAGCGGAGG - Exonic
1031986068 7:128165610-128165632 TGAGGGAAGGGCAGCAGCGGTGG + Intergenic
1032097643 7:128947502-128947524 TGGGGGCTGATCAGCAGGTCTGG - Exonic
1032532970 7:132637168-132637190 TGGGGGATGAGGAATAGGGGAGG - Intronic
1033184196 7:139210916-139210938 AGGAGGAAGAGAAGCAGGGGAGG + Intergenic
1033316013 7:140298416-140298438 CAGGGGAGGAGCACCAGGGGAGG - Intronic
1034115171 7:148577810-148577832 TGGGGGGTGAGGAGCATGGGAGG + Intergenic
1034286236 7:149885018-149885040 TGGGGGAGGGGGAGCACGGGAGG + Intergenic
1034963081 7:155374335-155374357 TGGGGGAGCGGGAGCAGGGGCGG + Intergenic
1035313636 7:157984728-157984750 TCGGGGATGAGCTGCATGTGGGG - Intronic
1035505535 8:126563-126585 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic
1035746718 8:1966341-1966363 TGGGGGAGGGGCAGCCGGGGAGG + Intergenic
1036988596 8:13566348-13566370 TCGGGGGTGGGGAGCAGGGGCGG - Intergenic
1037175370 8:15940697-15940719 CGGGGGCTGAGGAGCTGGGGAGG + Intergenic
1037259315 8:16989528-16989550 TGGGGGATGGGGGGCAGGGGAGG + Intergenic
1037509125 8:19563849-19563871 TGGGGGAGGGGCTGAAGGGGAGG - Intronic
1037817534 8:22120019-22120041 TGGGGGCAGAGGAGGAGGGGAGG + Intronic
1037839304 8:22232470-22232492 TGGGGGGTGTGAAGCTGGGGTGG + Intergenic
1038565835 8:28619488-28619510 CCAGGGAGGAGCAGCAGGGGTGG - Intronic
1040079778 8:43274937-43274959 TGAGGGAGGAGGAGGAGGGGAGG - Intergenic
1041292267 8:56319241-56319263 TGGGGATTGAGGAGCAGAGGGGG - Intronic
1041645500 8:60247398-60247420 TGGGGGTGGAGCGGAAGGGGAGG - Intronic
1041674065 8:60520485-60520507 TGAGCGTTGAGCAGCAGGGAGGG - Intronic
1041961444 8:63621681-63621703 TGGGTATTGAGCAGCAGGGAAGG + Intergenic
1042556412 8:70037091-70037113 TGGGGGATCAGAAGCAAGGTAGG - Intergenic
1042774378 8:72413749-72413771 TGGGGGATGATCAGTAGAGATGG + Intergenic
1044340496 8:91041012-91041034 AGTGGGAGGAGCAGCAGTGGAGG + Exonic
1044780021 8:95734459-95734481 TGGTGGATGAGGAGCAGGGATGG + Intergenic
1045040545 8:98219737-98219759 TTGATGATGAACAGCAGGGGAGG - Intronic
1045244248 8:100429163-100429185 TCTGGGATGAGCAGCAGGAAGGG + Intergenic
1045320679 8:101079785-101079807 AGCTGGAAGAGCAGCAGGGGAGG + Intergenic
1046395604 8:113634125-113634147 TGTGGCAGGAGCAGCAGTGGCGG - Intergenic
1046503790 8:115111679-115111701 TGGGGGGTGATGAGCATGGGAGG - Intergenic
1047527360 8:125644996-125645018 TGGGGGAGGAGGAGAAGGGAAGG - Intergenic
1047732102 8:127736371-127736393 TGGGGGATCAGCGGGAGGGCTGG - Exonic
1047880369 8:129186255-129186277 GGGGTGATGAGCAGCAAGGGTGG - Intergenic
1047962156 8:130018225-130018247 TGGGGGCTGAGAAGTAGGTGGGG + Intergenic
1048941957 8:139407558-139407580 TGGGGGATGAGAAGGAGTGAAGG + Intergenic
1048971157 8:139645616-139645638 TGGGGCATGGGCAGGAGGGAGGG - Intronic
1049282454 8:141757037-141757059 TGGGAGATGAGGAGAAAGGGTGG + Intergenic
1049282737 8:141758742-141758764 TGGAGGAGGAGGTGCAGGGGAGG - Intergenic
1049418902 8:142508212-142508234 TGGTGGCTGTGCAGCAAGGGAGG - Intronic
1049440304 8:142606544-142606566 TGGGGGAGGAACAACAGGAGGGG - Intergenic
1049547974 8:143243385-143243407 AGGGGGATGAGGGGGAGGGGAGG + Intergenic
1049574626 8:143384527-143384549 GGGGGGGGGGGCAGCAGGGGAGG - Intergenic
1049653785 8:143788991-143789013 TGGAGGCTGAGCAGCAGCGCCGG + Intergenic
1049670975 8:143869747-143869769 TGGAGGACGTGCAGGAGGGGAGG - Exonic
1049674437 8:143883409-143883431 TGGCGGATGAGGGGCTGGGGAGG + Intergenic
1049696676 8:143987344-143987366 GGAGGGAGGAACAGCAGGGGTGG - Intronic
1049757628 8:144317809-144317831 TGGGTGAAGAACAGCTGGGGGGG + Exonic
1051146193 9:14030187-14030209 CGGTAGATGAGCAGCAGCGGGGG + Intergenic
1053158057 9:35793607-35793629 TGGGTGGGGAGCAGCAAGGGAGG + Intronic
1053199101 9:36140722-36140744 TGGGAGATTTGGAGCAGGGGAGG + Intronic
1053575562 9:39355572-39355594 AGGGGGAGGTGCAGCAGGAGGGG - Intergenic
1053840070 9:42183511-42183533 AGGGGGAGGTGCAGCAGGAGGGG - Intergenic
1053904514 9:42827104-42827126 AGGGTGGTGAGCAGCAGGAGTGG + Intergenic
1054097123 9:60914259-60914281 AGGGGGAGGTGCAGCAGGAGGGG - Intergenic
1054118529 9:61189888-61189910 AGGGGGAGGTGCAGCAGGAGGGG - Intergenic
1054530472 9:66178411-66178433 AGGGTGGTGAGCAGCAGGAGTGG - Intergenic
1054589228 9:66992676-66992698 AGGGGGAGGTGCAGCAGGAGGGG + Intergenic
1054889046 9:70232356-70232378 TGGGGGAACAGAAGCAGGGTGGG + Intergenic
1055293196 9:74805728-74805750 TTGGGGATGAGGAGGAGGTGAGG + Intronic
1055731131 9:79280179-79280201 GGGGGCTTGAGCAGCAGTGGTGG + Intergenic
1056034873 9:82593788-82593810 TGGGGGGTGAGAAGGAGGTGGGG + Intergenic
1056137635 9:83645992-83646014 TGGGGGATGCAGAGCAGGAGGGG + Intergenic
1057181063 9:93030704-93030726 TGGCGGGGGGGCAGCAGGGGGGG + Intronic
1057266350 9:93620346-93620368 TGGGGCAGGGGCAGCAGGTGAGG + Intronic
1057593515 9:96394348-96394370 TGGGGGATGAGGGGCAGGTAAGG + Intronic
1057666408 9:97048866-97048888 TGGGGTAGGAGCAGCAGAAGAGG - Intergenic
1059061584 9:111038851-111038873 TGGGGTAAGCGCAGGAGGGGCGG - Intergenic
1059450963 9:114371203-114371225 TGCGGGATCTGCAGCTGGGGAGG - Intronic
1060348426 9:122836970-122836992 TGGGGGATGGGTGCCAGGGGAGG - Intergenic
1060421517 9:123472759-123472781 TGGGGAATGAGGAGCCGCGGTGG - Intronic
1060431319 9:123553403-123553425 GGAGGGATGAGGAGCGGGGGGGG - Intronic
1060496721 9:124124853-124124875 TGGCAGGTGAGCAGCAGGCGAGG + Intergenic
1060825952 9:126688313-126688335 TGGGGAAGGGGCAGCAGGGCGGG - Intronic
1061094257 9:128445440-128445462 TGGAGGTGGTGCAGCAGGGGTGG - Intergenic
1061306558 9:129736091-129736113 TGGGGGGTGTGGAGAAGGGGTGG - Intergenic
1061895351 9:133644114-133644136 TGGGGCCTGAGCCTCAGGGGTGG - Intronic
1062678343 9:137761943-137761965 AGGCTGTTGAGCAGCAGGGGCGG - Intronic
1203602776 Un_KI270748v1:30814-30836 TGTGGGGTGAGGAGTAGGGGAGG + Intergenic
1185603703 X:1355267-1355289 TGGAGGAAGAGGAGCAGGAGGGG + Intronic
1186157496 X:6740763-6740785 TGTGGGATGAGGAGCACGAGAGG - Intergenic
1186361868 X:8850671-8850693 TGGGAGATGACCAGCAGGAAAGG + Intergenic
1186699055 X:12069742-12069764 AGGGGGAAGAGAAGCAGGAGAGG + Intergenic
1188871896 X:35382851-35382873 TGGGGGAGGAGCAGAAAGGCTGG - Intergenic
1189232950 X:39466261-39466283 TGGGGGCTGAACAGCAGGATGGG - Intergenic
1189350199 X:40270180-40270202 TGGGACAGGAGAAGCAGGGGTGG + Intergenic
1190739637 X:53280640-53280662 TGGGGGCACAGCATCAGGGGTGG - Intronic
1192062453 X:67842224-67842246 TAGGGGATGAGGAGGAGGTGGGG + Intergenic
1192213973 X:69145079-69145101 TGGGGGGTGAGGAGGAGGGAGGG + Intergenic
1192432460 X:71121704-71121726 TGGGGGCTGAGGAGCAGGGGTGG - Exonic
1192561551 X:72131161-72131183 GGCGGGATGGGCAGCAGAGGGGG + Exonic
1192906169 X:75553500-75553522 TGGGGGGTGGGCAGCAGGCGTGG - Intergenic
1192907941 X:75571597-75571619 TGGGGGCTGAGGAGGAGGTGGGG - Intergenic
1192952223 X:76029117-76029139 TGGGGGGTGAGGGGTAGGGGAGG + Intergenic
1193047874 X:77071371-77071393 TGGGGGATGGGGATGAGGGGTGG - Intergenic
1193099839 X:77597049-77597071 TGGGGCAGCAGCAGCAGGGAAGG + Intronic
1193954659 X:87844698-87844720 TGGGGGGTGGGCAGCAAGGTTGG + Intergenic
1193970046 X:88039616-88039638 TGGGGCAGCAGCAGCAGTGGTGG - Intergenic
1194114036 X:89873722-89873744 TGGCGTAGGGGCAGCAGGGGTGG + Intergenic
1194193278 X:90862688-90862710 TGTGGGATGAGGTGGAGGGGAGG - Intergenic
1194255003 X:91624416-91624438 AGGGTGTTGAGCAGCAGGGCTGG + Intergenic
1195333866 X:103830989-103831011 TAGGGGAAGAGCAACTGGGGAGG + Intronic
1195938137 X:110144706-110144728 TGGGTCCTGAACAGCAGGGGAGG + Intronic
1196950912 X:120875153-120875175 TGGGACAGCAGCAGCAGGGGAGG + Exonic
1198017202 X:132623447-132623469 TGGAGGAAGAGCAGGAGGGAAGG + Intergenic
1198212509 X:134529346-134529368 ATGGGGAAGGGCAGCAGGGGTGG + Intergenic
1198551995 X:137755229-137755251 TGCTTGATGAGTAGCAGGGGAGG - Intergenic
1199600597 X:149539426-149539448 TGGGGGCGGAACAGCTGGGGCGG - Intergenic
1199649974 X:149940473-149940495 TGTGGGAGGAACAGCTGGGGCGG + Intergenic
1200034772 X:153320149-153320171 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200034775 X:153320167-153320189 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200034778 X:153320185-153320207 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045363 X:153398030-153398052 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045370 X:153398066-153398088 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045373 X:153398084-153398106 TGAGGGAAGAGCAGCAGGTGAGG - Intergenic
1200045380 X:153398120-153398142 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045387 X:153398156-153398178 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045398 X:153398210-153398232 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045409 X:153398264-153398286 TGAGGGAGGAGCAGCAGGTGAGG - Intergenic
1200045413 X:153398282-153398304 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045420 X:153398318-153398340 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045431 X:153398372-153398394 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045441 X:153398426-153398448 TGAGGTAGGAGCAGCAGGTGAGG - Intergenic
1200133155 X:153862370-153862392 TGGGGGAGAAGAAGTAGGGGTGG - Exonic
1200136625 X:153878364-153878386 TGGTGGAGAAGCAGCAGGGTGGG + Intronic
1200242909 X:154507112-154507134 TGGGGCGTGAGCAGCTGGGGAGG + Intronic
1200539894 Y:4445070-4445092 TGTGGGATGAGGTGGAGGGGAGG - Intergenic
1200573788 Y:4864019-4864041 AGGGTGTTGAGCAGCAGGGCTGG + Intergenic
1200764128 Y:7066130-7066152 TGGAGGAGGAGCATCAGTGGTGG - Intronic
1201300285 Y:12498871-12498893 TGGGGGAGGAGGAGGAGGTGGGG - Intergenic
1202384847 Y:24315859-24315881 TGTGGGGTGAGGAGTAGGGGAGG + Intergenic
1202485937 Y:25354263-25354285 TGTGGGGTGAGGAGTAGGGGAGG - Intergenic