ID: 1173802440

View in Genome Browser
Species Human (GRCh38)
Location 20:45902776-45902798
Sequence CCTTTGCCACACAAAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173802437_1173802440 10 Left 1173802437 20:45902743-45902765 CCAAAACTCTCACATCTGCATCT 0: 1
1: 0
2: 0
3: 33
4: 290
Right 1173802440 20:45902776-45902798 CCTTTGCCACACAAAGAAACAGG 0: 1
1: 0
2: 2
3: 19
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173802440 Original CRISPR CCTTTGCCACACAAAGAAAC AGG Intronic
900641328 1:3689367-3689389 CCTCTGCCACAGGAAGAGACGGG + Intronic
902075188 1:13778988-13779010 CCTTTGGCACACAGATTAACCGG + Exonic
904482338 1:30801837-30801859 CATTTGCCTCCCAAAGACACGGG + Intergenic
904768168 1:32866285-32866307 CCTTAGGCACACAGAAAAACAGG - Intronic
906594069 1:47057851-47057873 CACTAGCCATACAAAGAAACAGG - Intergenic
908475049 1:64479133-64479155 CCTTTGTATCACAAAGAAATTGG - Intronic
910724095 1:90320444-90320466 CATTTGGCACACAGAGAAGCAGG - Intergenic
911713429 1:101101158-101101180 CCTTTGCCACACAAGCAAAAAGG - Intergenic
912278289 1:108284529-108284551 ATTTTGGCAAACAAAGAAACTGG - Intergenic
912289937 1:108409828-108409850 ATTTTGGCAAACAAAGAAACTGG + Intronic
912973249 1:114304218-114304240 CCTTTGCTAGTCAAAGAAAGGGG + Intergenic
913153283 1:116067009-116067031 CCTTGTCCACACACTGAAACAGG - Exonic
913510683 1:119558918-119558940 CCTTTGCTACACTGAGAACCAGG - Intergenic
913931329 1:124967620-124967642 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
914391929 1:147231831-147231853 CCTTTGCTAGTCAAAGAAAGGGG - Intronic
915630215 1:157148183-157148205 CCTTTCCCACACAGTAAAACAGG - Intergenic
915748891 1:158186087-158186109 CCTTTGGCACAGGAGGAAACTGG - Intergenic
915872396 1:159574861-159574883 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
915875086 1:159603977-159603999 CCTTTTCTACTCAAAGAAAGGGG + Intergenic
916013510 1:160727818-160727840 CCTTTGCTACCCAAAGAACTTGG + Intergenic
916313718 1:163424656-163424678 ACTTTGCCAAACAAAGACAATGG + Intergenic
916333668 1:163645795-163645817 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
916979051 1:170113542-170113564 CCTTTGCTAGTCAAAGAAAGGGG - Intergenic
917127032 1:171696174-171696196 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
917298492 1:173547464-173547486 AATTTGCCAGACATAGAAACAGG + Intronic
917379065 1:174383569-174383591 CCTTTCCCAGTCAAAGAAAGCGG - Intronic
917398092 1:174615983-174616005 CCTTTGCTAGCCAAAGAAAGGGG - Intronic
917429060 1:174946573-174946595 CTTAAGCCTCACAAAGAAACTGG - Intronic
918746992 1:188215288-188215310 CCTATTATACACAAAGAAACTGG - Intergenic
919270689 1:195339933-195339955 CTCTTGCCACACAAAAAAATAGG - Intergenic
919426571 1:197439845-197439867 CTTTTGCATCACAAAGACACAGG + Intronic
919795614 1:201319804-201319826 CCTGTCCCACAGAAAGAGACTGG + Exonic
920102197 1:203523987-203524009 TCCTAACCACACAAAGAAACTGG - Intergenic
921880007 1:220245380-220245402 CCTTTGCGAGTCAAAGAAAGTGG + Intronic
921942080 1:220852504-220852526 TCTTTCCCACACAAACAAAATGG - Intergenic
923599263 1:235387704-235387726 CCTTTGCTAGTCAAAGAAAGGGG - Intronic
924269282 1:242316052-242316074 CTTTTTCCACACGAGGAAACAGG - Intronic
924390288 1:243547755-243547777 CCTTTGACACACAATTAAAATGG + Intronic
924546135 1:245029598-245029620 CCTTTTCCAAAAAAAAAAACAGG - Intronic
924552996 1:245095643-245095665 CCTTGGCCTCCCAAAGAACCGGG + Intronic
924858016 1:247894100-247894122 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1062824565 10:558237-558259 ACTTTGCTAGAGAAAGAAACAGG + Intronic
1064011249 10:11738226-11738248 CGTTTGACAGACAAGGAAACAGG + Intergenic
1064428245 10:15248989-15249011 ATTTTTACACACAAAGAAACAGG + Intronic
1065343371 10:24725208-24725230 CCTGTCCCCCATAAAGAAACAGG - Intergenic
1066051039 10:31635906-31635928 CCTGGGCCACTCAAAGACACTGG + Intergenic
1066715619 10:38282715-38282737 CTTTTTCCACACGAGGAAACAGG + Intergenic
1067218002 10:44318606-44318628 CTTTTGTCAAACAAAGAAAGTGG + Intergenic
1068704900 10:60064360-60064382 CAATTGCCACAAAAAGAAAAGGG + Intronic
1069241450 10:66145276-66145298 CCTTCTCCACACAAAGACAAAGG + Intronic
1070145253 10:73769276-73769298 CCTTTGCTACACTATTAAACTGG - Intronic
1071912394 10:90250839-90250861 CCTTTCCTACTCAAAGAAAGTGG + Intergenic
1072079894 10:92018462-92018484 CCTTTCCCACTCAAAGTACCTGG - Intronic
1073491242 10:103854975-103854997 CCAATGCCAAAAAAAGAAACCGG + Intronic
1073544258 10:104335679-104335701 CCTTTGACAGAGAAAGAAAAAGG + Intronic
1073587595 10:104725876-104725898 CCTTTCCTACTCAAAGAAACGGG - Intronic
1074690959 10:116003679-116003701 CCCTTTCCACCCAAACAAACAGG - Intergenic
1075563202 10:123483285-123483307 TGTTTGACACACAAAGAATCCGG + Intergenic
1077673260 11:4176026-4176048 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1078979845 11:16520714-16520736 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1079204187 11:18399708-18399730 CCTCCCCCTCACAAAGAAACTGG + Intronic
1079537055 11:21527171-21527193 CTTTTGCTACACAAAGAGACTGG - Intronic
1079832104 11:25281224-25281246 CCTTTCCTAGTCAAAGAAACAGG - Intergenic
1080209717 11:29771572-29771594 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1080721315 11:34851710-34851732 GGTTAGCCACACACAGAAACTGG + Intergenic
1081039362 11:38191967-38191989 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1082596132 11:55084595-55084617 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1082606396 11:55238734-55238756 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
1082970477 11:59015463-59015485 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1083604404 11:63969277-63969299 CCTGAGCTACAGAAAGAAACAGG - Intergenic
1084469711 11:69351683-69351705 TATTTGACATACAAAGAAACAGG - Intronic
1084869565 11:72088785-72088807 CATTTTCCAGACAAAGAAATGGG + Intronic
1084902515 11:72320353-72320375 CCTTTGCCCAAGAAATAAACAGG - Intronic
1085222579 11:74887663-74887685 CCTTTCCTACTCAAAGAAAGGGG + Intronic
1086744304 11:90405852-90405874 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1086778493 11:90871460-90871482 CCTTTGCCAGTCAAAGTCACAGG - Intergenic
1087275681 11:96158398-96158420 CCTGTGCCACACAGGGAAACTGG - Intronic
1087330796 11:96777574-96777596 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1090411861 11:126514675-126514697 CATTTTACACAGAAAGAAACAGG + Intronic
1090746871 11:129712772-129712794 CCTTTTCCAGTCAAAGAAAGGGG + Intergenic
1091052272 11:132383646-132383668 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1091140124 11:133227680-133227702 GCATTTCCAGACAAAGAAACAGG - Intronic
1091317518 11:134624895-134624917 CCTCTGCCACACAAGAAACCAGG - Intergenic
1091756954 12:3059687-3059709 CATTTGCCACTCAAAGAAACAGG - Intergenic
1092324050 12:7510192-7510214 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1093571206 12:20668060-20668082 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1093615278 12:21214843-21214865 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1094806250 12:34095947-34095969 ACTTTGACTCACAAAGAAATTGG + Intergenic
1096032634 12:48434003-48434025 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1097261356 12:57722021-57722043 CCTTGGGCATACTAAGAAACTGG - Intergenic
1098062543 12:66578493-66578515 CCTTTCCTAGTCAAAGAAACGGG + Intronic
1101537103 12:105628487-105628509 CCTTTCCAACTCAAAGAAAGGGG + Intergenic
1103431489 12:120891015-120891037 CCTTTGCTACACAATGACTCTGG + Intronic
1104239171 12:126970684-126970706 CCCCTGACTCACAAAGAAACAGG - Intergenic
1105061186 12:133152528-133152550 CCTTAGCCTCCCAAAGAACCAGG + Intronic
1105072694 12:133245167-133245189 CCTTTCCTAGACAAAGAAAGGGG + Intergenic
1105586461 13:21749016-21749038 CATTATCCACACAAACAAACAGG - Intergenic
1105893420 13:24698516-24698538 ACTTGGCCACAGAAAGAAAAAGG + Intronic
1105978269 13:25492849-25492871 CCTTTGGCAAAAGAAGAAACTGG + Intronic
1106977626 13:35239803-35239825 CATTTGCCAATGAAAGAAACTGG + Intronic
1107721843 13:43257648-43257670 CATTTTCCACAAAAAGAAAATGG + Intronic
1107980481 13:45729994-45730016 CGTTTGCCACACAGAAAAACAGG + Intergenic
1108565837 13:51696081-51696103 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1110449814 13:75628948-75628970 ACTGTTCTACACAAAGAAACTGG - Intronic
1111901009 13:94199818-94199840 CCTTGACCACACACAGAAACTGG + Intronic
1113122158 13:106935116-106935138 CCTTTCCGAGACAAAGAAAGGGG - Intergenic
1113206854 13:107926459-107926481 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1113246598 13:108403225-108403247 TCTTGGCCACATAAAGAAAGAGG + Intergenic
1113274201 13:108710016-108710038 CCTTTTCATCACAGAGAAACAGG - Intronic
1114801893 14:25784633-25784655 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1114828198 14:26106635-26106657 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1114869215 14:26635052-26635074 CCTTTCCGACTCAAAGAAAGGGG - Intergenic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1114982914 14:28188666-28188688 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1114993577 14:28318282-28318304 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1115472521 14:33783147-33783169 CATCTGCCACACAAACAAAGGGG + Intronic
1115727708 14:36235175-36235197 CTGTTGCCACACAAACAAATAGG + Intergenic
1116322797 14:43492402-43492424 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1116714228 14:48407575-48407597 CTCTTGCTATACAAAGAAACTGG - Intergenic
1116769856 14:49114607-49114629 CTTTTGGAACACAGAGAAACAGG - Intergenic
1116866111 14:50032917-50032939 CCTTGGCCACACAAAGTACTGGG + Intergenic
1116946463 14:50839865-50839887 CTCTTGGCACACAAAGAACCTGG - Intergenic
1117456439 14:55901938-55901960 CCATTGCCAGATGAAGAAACTGG + Intergenic
1117853569 14:60003022-60003044 CTCTTGCCAAACATAGAAACTGG + Intronic
1118831358 14:69436393-69436415 TATTTGACATACAAAGAAACAGG - Intronic
1120570547 14:86111252-86111274 CCTTTCCGACTCAAAGAAAGGGG - Intergenic
1121775609 14:96588585-96588607 CCTTCGGCACCCAAAGAAAGCGG - Intergenic
1121892389 14:97606856-97606878 ATTTTGCCACACAAACAAATAGG + Intergenic
1122655148 14:103253693-103253715 CCTTGGCCTCACAAAGCACCGGG + Intergenic
1123632032 15:22268204-22268226 CCTTTGCCACACTGAGCTACTGG - Intergenic
1124514145 15:30352009-30352031 CATTTACCACAGAAAGAAAAGGG + Intergenic
1124728775 15:32178755-32178777 CATTTACCACAGAAAGAAAAGGG - Intergenic
1125055726 15:35357183-35357205 CCTTTGCTAGTCAAAGAAAGCGG - Intronic
1125058614 15:35391742-35391764 CCTTTCCTACTCAAAGAAAAGGG - Intronic
1125222786 15:37358641-37358663 CCTTTCCCTAACAAAGAAATTGG - Intergenic
1125290678 15:38142598-38142620 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
1126592692 15:50355388-50355410 CTTCAGCCACACAAAGAAAGCGG + Intronic
1127098777 15:55541634-55541656 CTACTGCCACACAAAGACACAGG + Exonic
1127186402 15:56485270-56485292 CTCTTGCTACACAAAGAGACTGG + Intergenic
1127269910 15:57391055-57391077 CCTTTTACATCCAAAGAAACAGG + Intronic
1127679854 15:61282921-61282943 CATTTGCTCCAGAAAGAAACTGG + Intergenic
1127740186 15:61896463-61896485 CCTTTCCTACTCAAAGAAAGGGG + Intronic
1128532642 15:68465056-68465078 ACTTTCCCACACAAAAAAATGGG + Intergenic
1128964156 15:72040677-72040699 CCTTTGCCTCCCGAAGAACCCGG + Intronic
1130049761 15:80474065-80474087 CCTTTGCCACTGAATGAAATGGG - Intronic
1130190466 15:81730506-81730528 CCTTTCCTAGTCAAAGAAACGGG + Intergenic
1131118612 15:89809339-89809361 CCTTTTCTAAACAAAGAAAGAGG + Intronic
1131325746 15:91442438-91442460 CATCTGCCACACACAAAAACAGG + Intergenic
1131584177 15:93675625-93675647 CCTTTGCGAGTCAAAGAAAGGGG + Intergenic
1132413746 15:101605718-101605740 TTTTTGGCACACAAAGAAAAAGG - Intergenic
1135567346 16:23521648-23521670 CCTTTGCCTCACAAAGCATTAGG + Intronic
1138012594 16:53397114-53397136 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1139751204 16:69109832-69109854 GCTGCGCCACACAAAGAAGCCGG - Exonic
1141970967 16:87482183-87482205 CCTTTGCCACACTGAGCTACTGG + Intronic
1143826837 17:9616211-9616233 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1144092084 17:11866925-11866947 CCTTTCCTAGTCAAAGAAACGGG - Intronic
1145036954 17:19547890-19547912 ATTGTGCCACACAAAGAAGCAGG - Intronic
1145988467 17:29063374-29063396 CCTTGGCCACACAAAGCACTGGG - Intergenic
1146580185 17:34030596-34030618 CCTTTCCTACTCAAAGAAAGGGG + Intronic
1147344717 17:39782247-39782269 CCTTTGAAACACAAAGAGCCAGG + Intronic
1147399306 17:40170125-40170147 CACTTGCCAAACAAACAAACTGG - Intronic
1151662972 17:75528963-75528985 CCTTGCCCACACAGTGAAACCGG + Intronic
1152912387 17:83012793-83012815 CCTATTCCCCACAAAGGAACTGG + Intronic
1153164575 18:2247392-2247414 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1154042670 18:10872629-10872651 CCTTTGCAACACTGAGCAACTGG + Intronic
1154986644 18:21558098-21558120 CCTCAGCCCCACCAAGAAACTGG + Intronic
1156004110 18:32419700-32419722 CCTTTGCCATACACATAATCTGG + Intronic
1156566568 18:38197986-38198008 CCTCTCCCAAACACAGAAACTGG - Intergenic
1156602771 18:38629950-38629972 TCTTTTCCACACAAAGATATTGG - Intergenic
1158119691 18:54035156-54035178 CCTTTGCAACTTAAAAAAACTGG - Intergenic
1158347001 18:56525789-56525811 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1159578410 18:70207104-70207126 AGTTTGCCACACAAAGAAGTTGG + Intergenic
1160493264 18:79355237-79355259 CCCTTGCCATACCAAGAACCAGG + Intronic
1160924257 19:1535541-1535563 CCTCTGCCACTAAGAGAAACAGG - Intergenic
1163028410 19:14527859-14527881 CTTTTGACAGACAAAGGAACAGG - Intronic
1163101025 19:15096606-15096628 CCTTGGCCTCCCAAAGCAACGGG + Intergenic
1163134142 19:15297139-15297161 CCTTTGACACACAAAGTCACAGG + Intronic
1163278944 19:16303348-16303370 CCTCTGCCACACAGATAATCCGG + Intergenic
1165270843 19:34706262-34706284 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
926236624 2:11050301-11050323 CATTTGACACAGAAGGAAACAGG - Intergenic
926455995 2:13069388-13069410 GCTTTGCCACAGAAAAAAATGGG + Intergenic
927171492 2:20374031-20374053 CCTTGGCCTCCCAAAGTAACTGG - Intergenic
927342435 2:21997588-21997610 ACTTTGCAACCCAAAGCAACTGG - Intergenic
930972889 2:57418933-57418955 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
931048823 2:58387320-58387342 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
931619965 2:64200072-64200094 CCTTTGAAAGATAAAGAAACTGG + Intergenic
932035193 2:68238382-68238404 CGTTTGCCAGACAGAGAAAGGGG + Intronic
932057545 2:68461601-68461623 TCCCTGCCACACAAAGAAAACGG - Exonic
932520186 2:72403950-72403972 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
933614802 2:84472574-84472596 CATTTGCCACATCAAGGAACAGG - Intergenic
933663726 2:84947812-84947834 CCTTGGCCTCACAAAGTACCGGG + Intergenic
934527038 2:95058486-95058508 ACTTTGCCATACAAAGAAGTCGG + Intergenic
934918430 2:98320634-98320656 CCTTTGCTATGCAAAGAGACTGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935876369 2:107512314-107512336 CCTTTGCCATTCAAATGAACAGG - Intergenic
936765465 2:115842539-115842561 CCTCTCTCATACAAAGAAACGGG - Intronic
936904892 2:117525611-117525633 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
937098309 2:119249764-119249786 CCTTTGCCACCCACAGATACCGG + Intronic
937277293 2:120693149-120693171 CCTTCTCCACTCAAAGAACCAGG + Intergenic
937286022 2:120751948-120751970 CTTTTGCATCAGAAAGAAACTGG - Intronic
939392760 2:141590343-141590365 CCTTTGTCTCACAAAGGAATAGG - Intronic
939486025 2:142812047-142812069 CCTTTCCTACCCAAAGAAAGGGG - Intergenic
939605360 2:144247939-144247961 CCTTGGCCTCCCAAAGTAACAGG + Intronic
939924370 2:148154711-148154733 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
940055322 2:149507158-149507180 CCTTTCCTAGACAAAGAAAGGGG - Intergenic
940253448 2:151704639-151704661 CCTTTCCGACTCAAAGAAAGGGG - Intronic
940608983 2:155966112-155966134 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
941374000 2:164705243-164705265 CATCTGCCACACACAGAAGCTGG + Intronic
941586769 2:167369127-167369149 CCTTCTCCACTCAAAGATACTGG - Intergenic
941646458 2:168046469-168046491 CCTTCACCACACCAAGACACGGG - Intronic
943921318 2:193710687-193710709 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
944206389 2:197162913-197162935 CCTATGCCACAATAAGAAAAGGG + Intronic
944262564 2:197693314-197693336 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
946659532 2:221984787-221984809 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
946793481 2:223324833-223324855 CATTTTACAAACAAAGAAACAGG + Intergenic
947498442 2:230655747-230655769 CATTTGCCACAGGAAGAAAGGGG - Intergenic
948269600 2:236664210-236664232 GTTTGGCCACACACAGAAACAGG + Intergenic
1169357197 20:4917266-4917288 CCTTTGGCACACGAGGAGACAGG + Intronic
1169654734 20:7910727-7910749 CTTTTGCCACATAAAGTAACAGG + Intronic
1172831611 20:37840324-37840346 CCTTTGACACGCAAAGCAACAGG - Intronic
1173624035 20:44458003-44458025 TCATTGCCACAAAAAGAGACCGG + Intronic
1173802440 20:45902776-45902798 CCTTTGCCACACAAAGAAACAGG + Intronic
1173986032 20:47262248-47262270 CAGTTGCCACAGAAAGATACTGG + Intronic
1174778080 20:53364032-53364054 CCTTTGAGAAAAAAAGAAACAGG + Intronic
1175668213 20:60878365-60878387 TCTATGCCACACATAGAGACCGG + Intergenic
1175772710 20:61633680-61633702 CCTTTCCCAGATGAAGAAACTGG - Intronic
1179225730 21:39451581-39451603 CTTTTGGCAAACAAATAAACTGG - Intronic
1180912203 22:19458691-19458713 CCTCGGCCACACAAAGAACTGGG + Intronic
1181964877 22:26649465-26649487 CCTTGGGCACACAAGGAAACAGG - Intergenic
1182158904 22:28102083-28102105 GCTTTGCCAGCCAAAGAATCAGG - Intronic
1182325908 22:29512720-29512742 CATTTTACACATAAAGAAACAGG + Intronic
1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG + Intronic
1182730023 22:32480914-32480936 CCTTGGCCACCCAAAGTAATGGG + Intronic
1184627486 22:45747946-45747968 CCTTGGCCCCACCAAGTAACTGG - Intronic
949179733 3:1114372-1114394 TTTCTGCCACACACAGAAACTGG - Intronic
949698194 3:6723542-6723564 CCTCAGCCATATAAAGAAACTGG - Intergenic
950767471 3:15283938-15283960 CATTTTACACCCAAAGAAACTGG + Intronic
951157821 3:19376378-19376400 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
951497739 3:23349469-23349491 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
951784615 3:26403802-26403824 CCTTTCCGACTCAAAGAAAGGGG - Intergenic
951862017 3:27263717-27263739 CCTTTCCTAGTCAAAGAAACGGG - Intronic
952612287 3:35226041-35226063 CCTTTCCTAGACAAAGAAAGGGG + Intergenic
954855236 3:53638542-53638564 GGTTTGCCACACGAAGACACTGG + Intronic
955268915 3:57477165-57477187 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
955295735 3:57733346-57733368 CCTTGGCCACACAAAGTTCCAGG - Intergenic
955328391 3:58027068-58027090 CCTTTCCCAGAAACAGAAACGGG - Intronic
956076281 3:65509517-65509539 CCTTTCCGACTCAAAGAAAGGGG + Intronic
956926123 3:73990936-73990958 CCTTTGCTAGTCAAAGAAAGGGG + Intergenic
958175916 3:89996200-89996222 CCTTTCCCAATCAAAGAAAGGGG + Intergenic
959366273 3:105461896-105461918 GCTTTCCCACATAGAGAAACAGG + Intronic
959423893 3:106161612-106161634 CCCCTGCCACACACATAAACTGG - Intergenic
960376644 3:116910409-116910431 CTTTTGCCCCACAAAGCAATGGG + Intronic
962398137 3:135035318-135035340 CTTTTTCCACTGAAAGAAACTGG + Intronic
963327685 3:143880360-143880382 CCTTGCCCTCACAAAGGAACAGG + Intergenic
963435247 3:145258389-145258411 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
964325548 3:155542121-155542143 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
964862744 3:161220432-161220454 TTCTTTCCACACAAAGAAACTGG + Intronic
965886432 3:173451959-173451981 CCTTTCCTAGTCAAAGAAACAGG - Intronic
966896368 3:184448175-184448197 CCTTGGCCTCCCAAAGTAACGGG + Intronic
967444065 3:189544333-189544355 CCTTTGCCACAAAAGGGATCTGG + Intergenic
967635089 3:191791469-191791491 CCCTTGCCATGCAAAGAGACTGG - Intergenic
968184783 3:196625114-196625136 CCTTTGGCACAGAAAGAACTCGG - Intergenic
968753901 4:2404979-2405001 CCTTGGCCACCCAAAGTAGCTGG + Intronic
969151818 4:5176201-5176223 CCTTTCCCAGACAAAGAAAGGGG - Intronic
969490315 4:7495897-7495919 CCTGGGCCACCCAGAGAAACAGG + Intronic
969807123 4:9617835-9617857 CCTTTCCTAGTCAAAGAAACAGG + Intergenic
969830890 4:9795781-9795803 CTCTAGCCACACAAGGAAACAGG - Intronic
969988413 4:11235453-11235475 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
972485754 4:39538754-39538776 CCTTGGCCTCACAAAGTACCTGG + Intergenic
973899746 4:55456682-55456704 CCTGTGTCAAACAAAGAAATAGG - Intronic
974780328 4:66545303-66545325 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
975158497 4:71098543-71098565 TTTTTTCCACAAAAAGAAACTGG + Intergenic
975287486 4:72637243-72637265 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
975444246 4:74444602-74444624 CCTGGGCCACATAAAGAAATAGG + Intergenic
976523956 4:86064548-86064570 GCTTAGAGACACAAAGAAACAGG - Intronic
976524959 4:86076173-86076195 CCTTTCCGAGTCAAAGAAACGGG - Intronic
976980765 4:91224434-91224456 CCATTGTCACACAAAGACATTGG - Intronic
977159369 4:93614091-93614113 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
977287532 4:95127646-95127668 CCATTTCCAAACAAGGAAACAGG - Intronic
977353268 4:95914985-95915007 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
977516241 4:98023934-98023956 CCTTTGCTAGTCAAAGAAAGGGG - Intronic
980317492 4:131221229-131221251 CATATGCCAAAGAAAGAAACTGG - Intergenic
982581201 4:157180670-157180692 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
983140318 4:164142033-164142055 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
984696457 4:182784834-182784856 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
985169320 4:187131558-187131580 CCTTTGGTACACAAAGTAACAGG + Intergenic
985229883 4:187803587-187803609 CTTTAGCCACACTAAGAAAAAGG + Intergenic
985755234 5:1710040-1710062 CCTTTCCCAGTCAAAGAAATGGG + Intergenic
989162756 5:38407342-38407364 CATTTGGCACACATAGAAATAGG - Intronic
989679669 5:44014017-44014039 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
989682014 5:44041130-44041152 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
989862008 5:46389429-46389451 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
992338528 5:75798528-75798550 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
992395644 5:76367192-76367214 CAGTAGCCTCACAAAGAAACTGG - Intergenic
992402737 5:76426617-76426639 CCTTTACAACACAAAGCAAAAGG - Intronic
992659558 5:78945178-78945200 CCTTTCCTACTCAAAGAAAGGGG - Intronic
993524145 5:88943754-88943776 CTTTTGCCACAGAAAGAAAAGGG + Intergenic
993707474 5:91187408-91187430 CATTTTCCAGACAAAGAAATGGG + Intergenic
994051675 5:95369329-95369351 CCTCTGCCACAGCAAGAAGCTGG - Intergenic
995922670 5:117332410-117332432 CCTTTGCCAAAACAAGAAAATGG - Intergenic
999382403 5:151130787-151130809 CATATGACGCACAAAGAAACTGG - Intronic
999606835 5:153325552-153325574 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1001985102 5:176067811-176067833 CCTTTGCCACATAATGGAAAGGG + Intronic
1002231763 5:177770324-177770346 CCTTTGCCACATAATGGAAAGGG - Intronic
1002263578 5:178013429-178013451 CCTTTGCCACATAATGGAAAGGG + Intronic
1003813418 6:9810976-9810998 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1006454409 6:34123712-34123734 CATTTTACACACAAGGAAACGGG + Intronic
1007223383 6:40296152-40296174 CTCTTGCCACACAAAGAAACTGG + Intergenic
1007579606 6:42949543-42949565 CCTTTCCCACACAAAGCAAATGG + Intergenic
1008377394 6:50807781-50807803 CCTTTGCAACACCAAGATGCTGG - Intergenic
1008409213 6:51153790-51153812 CCTTGGCCATTCAAAGAAAGAGG + Intergenic
1009878501 6:69535964-69535986 CATTTGCCTCACAAAGTTACAGG - Intergenic
1010834867 6:80573699-80573721 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1010856561 6:80847965-80847987 CCTTTTCTACTCAAAGAAAGGGG + Intergenic
1011181481 6:84626579-84626601 CCTTTCCGAGTCAAAGAAACGGG + Intergenic
1013010278 6:106114253-106114275 CCCTTGCCACAAAAAGGAAAGGG + Intergenic
1014345893 6:120268642-120268664 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1014381490 6:120748577-120748599 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1014702979 6:124712597-124712619 CCTTTCCGACTCAAAGAAAGGGG - Intronic
1015162548 6:130169603-130169625 CCTTTGCTACAGAAAGAACAGGG - Intronic
1015261294 6:131240807-131240829 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1016213290 6:141566331-141566353 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1016226552 6:141746247-141746269 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1016231788 6:141815040-141815062 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1016643413 6:146377427-146377449 CTTTTGCTATACAAAGAGACTGG + Intronic
1016844666 6:148558808-148558830 CCTTTGACTCTGAAAGAAACGGG - Intergenic
1018940551 6:168306871-168306893 CATGTGCCACACAAGGAATCAGG + Intronic
1019618551 7:1978291-1978313 CCCTTGCCACACAGAGCAGCGGG - Intronic
1019752893 7:2743763-2743785 CCTTTCCTACTCAAAGAAAGGGG + Intronic
1020772443 7:12411913-12411935 CCCTTGCCACAAAAAAAAAAAGG + Intergenic
1020881297 7:13765868-13765890 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1020884667 7:13806491-13806513 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1020957441 7:14759173-14759195 CCTTAGCCACCCAAAGAACTGGG + Intronic
1021374545 7:19889863-19889885 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1022352642 7:29580160-29580182 CCTTTCCGAGTCAAAGAAACGGG + Intergenic
1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG + Intronic
1022911862 7:34906464-34906486 CCTTTCCTAATCAAAGAAACGGG + Intergenic
1023351387 7:39323447-39323469 CCACTTCCACACATAGAAACAGG - Intronic
1023576768 7:41636215-41636237 CATTTTACACACAAGGAAACTGG + Intergenic
1024823800 7:53365514-53365536 CCTATGCTTAACAAAGAAACAGG + Intergenic
1024862006 7:53855256-53855278 AATTTGCCACACAAAGATATAGG + Intergenic
1025122174 7:56314433-56314455 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1025204559 7:56984785-56984807 CCTTGGCCTCACAAAGTACCTGG + Intergenic
1025667378 7:63592150-63592172 CCTTGGCCTCACAAAGTACCTGG - Intergenic
1026748188 7:73028985-73029007 CCTTGGCCACCCAAAGAGATGGG - Intergenic
1026751836 7:73057130-73057152 CCTTGGCCACCCAAAGAGATGGG - Intergenic
1026755485 7:73085257-73085279 CCTTGGCCACCCAAAGAGATGGG - Intergenic
1026759136 7:73113271-73113293 CCTTGGCCACCCAAAGAGATGGG - Intergenic
1027034391 7:74914299-74914321 CCTTGGCCACCCAAAGAGATGGG - Intergenic
1027088273 7:75280202-75280224 CCTTGGCCACCCAAAGAGATGGG + Intergenic
1027091915 7:75308130-75308152 CCTTGGCCACCCAAAGAGATGGG + Intergenic
1027095558 7:75336097-75336119 CCTTGGCCACCCAAAGAGATGGG + Intergenic
1027323783 7:77031589-77031611 CCTTGGCCACCCAAAGAGATGGG - Intergenic
1028295209 7:89120755-89120777 CTTCTGCCACACAAACAAAATGG - Intronic
1028383483 7:90225494-90225516 CCTTTGACAATCAAAGAATCTGG - Exonic
1028478018 7:91272785-91272807 CCTTTGCCTCCCGAAGAAATGGG + Intergenic
1028507866 7:91589875-91589897 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1028767098 7:94571763-94571785 ATTTTGCCACACAGAGAAGCTGG - Intergenic
1029169371 7:98619872-98619894 CCACTGCCAGACAGAGAAACAGG - Intronic
1029395667 7:100306823-100306845 CCTTGGCCACCCAAAGAGATGGG + Intergenic
1029698825 7:102232846-102232868 CCTTTGCTAAATAAAGTAACTGG - Intronic
1029831255 7:103262176-103262198 CCTTGACCACATGAAGAAACTGG + Intergenic
1030439716 7:109572899-109572921 CCCTTTCCAGACAAAGCAACTGG + Intergenic
1030893713 7:115030867-115030889 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1031769844 7:125829684-125829706 CTTTTGCTATACAGAGAAACTGG - Intergenic
1032736062 7:134693604-134693626 CCTGTGCCACATACTGAAACAGG - Intergenic
1034974228 7:155438638-155438660 CCTTTGTCAGAGAAAGACACAGG - Intergenic
1035027451 7:155835336-155835358 CCTTGGCCTCCCAAAGAAATGGG + Intergenic
1036448498 8:8844176-8844198 GCTTTGTCATCCAAAGAAACAGG + Intronic
1038436661 8:27541209-27541231 CTTTTGGGACACAAAGAAGCCGG - Intronic
1038438471 8:27555188-27555210 CCTTTCCTAGACAAAGAAAGGGG - Intergenic
1039238979 8:35533826-35533848 CCTTTGCGAGTCAAAGAAAGGGG - Intronic
1039698179 8:39934844-39934866 ACTTTGCCACAGAAAGAAGATGG + Intronic
1039775837 8:40735859-40735881 CCTTTTCCAGAGAAAGAAAGAGG + Intronic
1041161537 8:55050120-55050142 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1041776683 8:61530289-61530311 CTTTTGCCACAAGAAGAAATGGG - Intronic
1042682928 8:71406586-71406608 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1042720324 8:71820487-71820509 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1042779893 8:72479659-72479681 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1043045904 8:75324444-75324466 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1043547510 8:81331633-81331655 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
1043739432 8:83791683-83791705 ACTTTGACACACAAATAAACAGG - Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1045592024 8:103608771-103608793 CCTTTCCCAGTCAAAGAAAGGGG - Intronic
1046422726 8:114006072-114006094 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1047335480 8:123931741-123931763 TATTTGCAACAAAAAGAAACAGG - Intronic
1048607147 8:135981368-135981390 CCCTTGCTATATAAAGAAACAGG + Intergenic
1049055100 8:140230190-140230212 CCTTTGCTGGACAAAGACACTGG + Intronic
1049665850 8:143842092-143842114 CCTCTGCCAAAGAAAGAAAGAGG - Intergenic
1050022952 9:1304029-1304051 CCTTTGACTAACATAGAAACAGG + Intergenic
1050031242 9:1388537-1388559 CCTTTCCAACAGAAAGAAACAGG + Intergenic
1050374193 9:4953607-4953629 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1051131028 9:13861192-13861214 CCTTTGCCACACATAAAAGGGGG + Intergenic
1051781486 9:20693070-20693092 CCGTTGCCACCCAAAGTAAAAGG + Intronic
1052080177 9:24195760-24195782 AATTAGCCACACACAGAAACAGG - Intergenic
1052239058 9:26249996-26250018 CCTTTCCTAGTCAAAGAAACGGG + Intergenic
1055395025 9:75864833-75864855 CCTTTGGGACACACAGAAAAAGG - Intergenic
1055617724 9:78090581-78090603 CCTTAGCCATACAAAGAACCCGG - Intergenic
1056975628 9:91250458-91250480 CCTTTTCCACACACGGAGACAGG + Intronic
1057631460 9:96722275-96722297 CCCTTGCAAAACAAAAAAACTGG + Intergenic
1057866482 9:98685937-98685959 CCTTGGCCTCACAAAGTATCGGG + Intronic
1058079952 9:100690939-100690961 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1059007291 9:110417328-110417350 CCTTTCCCAGTCAAAGAAAGGGG + Intronic
1059423536 9:114207004-114207026 TCTTTTACACACAAAGAAACTGG + Intronic
1059715846 9:116912680-116912702 CCTCTGCCACAGCAATAAACAGG - Intronic
1059728774 9:117035597-117035619 CCTTTGGCAGATACAGAAACTGG - Intronic
1059921946 9:119169341-119169363 CCTTTCCGAAACAAAGAAAGGGG + Intronic
1185720223 X:2375389-2375411 CCTTTTCCACAAGAAGAAAAAGG - Intronic
1185802457 X:3026056-3026078 GCTCTGCCCCACAAAGATACAGG + Intronic
1186637122 X:11418473-11418495 TCCTTGCCAAACAAAGAAAAAGG - Intronic
1187421966 X:19142894-19142916 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1187645185 X:21339690-21339712 CCTTTCCCAGTCAAAGAAAGGGG + Intergenic
1188187392 X:27131371-27131393 CCCTTGCTATACAAAGAGACTGG - Intergenic
1188241766 X:27801266-27801288 CCTTTGCTAGTCAAAGAAAGGGG + Intergenic
1188249156 X:27870724-27870746 CTCTTGCCACACAAAAAAAATGG - Intergenic
1188895516 X:35663467-35663489 CATTTTACACAGAAAGAAACTGG - Intergenic
1190048462 X:47131523-47131545 CCTTTTCTACAAGAAGAAACAGG + Intergenic
1190324037 X:49195725-49195747 CCTTTGCTACACAAAGGCATTGG - Intronic
1190602406 X:52106503-52106525 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1191049695 X:56178001-56178023 CCTTTCCCAGCCAAAGAAAGGGG - Intergenic
1191092294 X:56636235-56636257 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1191144582 X:57152670-57152692 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1191586317 X:62830599-62830621 CCTTTATAACACAAAAAAACTGG + Intergenic
1191649288 X:63519346-63519368 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1191704962 X:64084759-64084781 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1192290465 X:69789072-69789094 CCTTTCCTACTCAAAGAAAGGGG - Intronic
1192598887 X:72440769-72440791 CCTTTCCTACTCAAAGAAAGGGG + Intronic
1192919057 X:75686290-75686312 CCTTTCCTAGACAAAGAAAGGGG - Intergenic
1193388117 X:80894669-80894691 CTTTTGCTATGCAAAGAAACTGG + Intergenic
1193426428 X:81345660-81345682 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1193922760 X:87449024-87449046 CCTTTGCTAGTCAAAGAAAGTGG - Intergenic
1194033556 X:88844003-88844025 CATTTGCCACATCAAGGAACAGG - Intergenic
1195395802 X:104409134-104409156 CCTTTCCTAGTCAAAGAAACTGG - Intergenic
1195723604 X:107891015-107891037 CCTTTCCTAGTCAAAGAAACGGG - Intronic
1195886549 X:109644892-109644914 CCTTTCCTAGTCAAAGAAACGGG + Intronic
1196643366 X:118089742-118089764 CATTTGCCATACCAAGAACCAGG + Intronic
1197008948 X:121537113-121537135 CCTTTCCTAGTCAAAGAAACGGG - Intergenic
1197752347 X:129974054-129974076 CCTTGGCCACACAAAGCATTGGG + Intergenic
1197812027 X:130453407-130453429 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1199710833 X:150467978-150468000 CATTTTACACATAAAGAAACTGG + Intronic
1200300567 X:154970526-154970548 ACTTTTACCCACAAAGAAACTGG + Intronic
1200689706 Y:6294639-6294661 CCTTTCCTACTCAAAGAAAGGGG - Intergenic
1201045566 Y:9880081-9880103 CCTTTCCTACTCAAAGAAAGGGG + Intergenic
1201230638 Y:11860847-11860869 CCTTTCCTAGTCAAAGAAACCGG - Intergenic
1201522268 Y:14888433-14888455 CCTTTCCTACTCAAAGAAAAAGG - Intergenic
1201988325 Y:19993768-19993790 CCTTTCCCAGTCAAAGAAAGGGG - Intergenic
1202579711 Y:26366976-26366998 CATTTGCCACACTGAGAAATTGG - Intergenic