ID: 1173803730

View in Genome Browser
Species Human (GRCh38)
Location 20:45911078-45911100
Sequence GCGGGGCCCGAGAAATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173803730_1173803741 11 Left 1173803730 20:45911078-45911100 CCCTGAGATTTCTCGGGCCCCGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1173803741 20:45911112-45911134 AGGCCCCGCCCCGGATCGCGAGG 0: 1
1: 0
2: 1
3: 6
4: 87
1173803730_1173803738 2 Left 1173803730 20:45911078-45911100 CCCTGAGATTTCTCGGGCCCCGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1173803738 20:45911103-45911125 CCACCGCCGAGGCCCCGCCCCGG 0: 1
1: 0
2: 3
3: 44
4: 339
1173803730_1173803732 -9 Left 1173803730 20:45911078-45911100 CCCTGAGATTTCTCGGGCCCCGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1173803732 20:45911092-45911114 GGGCCCCGCCTCCACCGCCGAGG 0: 1
1: 0
2: 2
3: 44
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173803730 Original CRISPR GCGGGGCCCGAGAAATCTCA GGG (reversed) Intronic
912616122 1:111101959-111101981 GTGGGGCCCTAGAACTCCCAAGG + Intergenic
916263780 1:162869306-162869328 GTGGGGCCCTAGAACTCCCAAGG - Intergenic
920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG + Intronic
922168141 1:223132837-223132859 GCTGGGCCAGAGATTTCTCAAGG - Intronic
1062844864 10:696137-696159 GCGGGTCCCCAGAAATCACAAGG - Intergenic
1064179153 10:13100061-13100083 GCGGGGCCCGGGAAATTCCCCGG + Intronic
1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG + Intronic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1071484758 10:86091581-86091603 GCGGGGCTCTAGAACTCCCAAGG - Intronic
1074065234 10:110007771-110007793 GCGGGGCCAGAGAGAGCTCGGGG + Intronic
1082693557 11:56332460-56332482 GAGGGGCCCGAGGAAGCCCAAGG - Intergenic
1089632884 11:119794479-119794501 GCGGAGCCCCAGAAAGCTCCCGG + Intergenic
1094732075 12:33188499-33188521 GTGGGCCCAGTGAAATCTCAAGG + Intergenic
1096347908 12:50866576-50866598 ACAGGGCCCTAGAACTCTCAAGG - Intronic
1103994363 12:124819574-124819596 GAGGGGCCCGAGATATGTCCCGG - Intronic
1109280664 13:60351434-60351456 GCTGGGCTGCAGAAATCTCAGGG + Intergenic
1115299275 14:31865741-31865763 GCGGGGCCCTAGAACTCCCAAGG - Intergenic
1119658325 14:76433114-76433136 GCAGGGCCCAAGAAATCTACAGG - Intronic
1121402102 14:93688890-93688912 GCTGAGCCCGAGGAAACTCAGGG - Intronic
1124904872 15:33858889-33858911 GCTTGGCCCGAGAAAGCACATGG - Intronic
1127717500 15:61663710-61663732 GAGGTGCCCGAGAAGTCTTAGGG - Intergenic
1129398989 15:75268970-75268992 GAGGGGCCAGAGAAATCAGAAGG - Intronic
1129402597 15:75293246-75293268 GAGGGGCCAGAGAAATCAGAAGG - Intronic
1129476130 15:75785671-75785693 GAGGGGCCAGAGAAATCAGAAGG - Intergenic
1133025862 16:2988709-2988731 GCGGGGCCCAGGAGAGCTCAGGG + Intergenic
1137409525 16:48216062-48216084 GCTGGGCCCCAGAAGTCCCAGGG - Intronic
1144937984 17:18915603-18915625 GCGGGTGCAGAGAAATCACATGG + Intronic
1146647084 17:34582636-34582658 GCGGGGAACCAGAAATCTCTAGG + Intronic
1146928533 17:36761889-36761911 GCGGGGCCTGAGAGGTCTCCTGG - Intergenic
1148072187 17:44914945-44914967 GGAGTGCCCGAGAAGTCTCAGGG - Intronic
1150786879 17:68170224-68170246 GCTGGACCGGAGAAATCCCAGGG + Intergenic
1162555014 19:11381347-11381369 GAGGAGCCCAAGAAAGCTCAGGG + Intronic
1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG + Intronic
938544714 2:132317432-132317454 ACCGAGCCCCAGAAATCTCAGGG + Intergenic
1173803730 20:45911078-45911100 GCGGGGCCCGAGAAATCTCAGGG - Intronic
1176386511 21:6140791-6140813 GCGTGGCCCGAGGAAGCTGAGGG + Intergenic
1179736962 21:43397461-43397483 GCGTGGCCCGAGGAAGCTGAGGG - Intergenic
1180057199 21:45365113-45365135 GCGGGGCGCCAGAAATCGCCTGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
949604013 3:5634236-5634258 GCGGGGCCCTAGAACTCCCAAGG + Intergenic
950498600 3:13349459-13349481 GCCGGGCCCCAGTATTCTCACGG - Intronic
952096507 3:29960593-29960615 GCAGGGACAGAGAACTCTCATGG - Intronic
961783267 3:129334077-129334099 GCCGGGCCCCAGTATTCTCATGG - Intergenic
984762515 4:183375334-183375356 GAGGGGCCCCAGACATCTGAAGG + Intergenic
991117406 5:62970156-62970178 GCAGGGCCCTAGAACTCCCAAGG - Intergenic
995481653 5:112599150-112599172 CCGGGGCAAGAGAAAACTCAGGG - Intergenic
1005760298 6:28961369-28961391 GCAGGGCCCTAGAACTCCCAAGG - Intergenic
1010633649 6:78230878-78230900 GTGGGGCCCTAGAACTCCCAAGG + Intergenic
1035222039 7:157411644-157411666 TCGGGGCCTGCGAAATCACAAGG - Intronic
1039633153 8:39134322-39134344 GCAGGGCCCGTGAAGGCTCAGGG + Intronic
1042472614 8:69208721-69208743 GAGGGTCCTGAGAAATCTGAAGG - Intergenic
1049245097 8:141558168-141558190 ATGGAGCCTGAGAAATCTCACGG + Intergenic
1053142027 9:35688484-35688506 GGGTGGGCAGAGAAATCTCAGGG + Intronic
1060594788 9:124841451-124841473 GCAGGGCCCCAGAGAGCTCAGGG - Intergenic
1189972822 X:46435212-46435234 GCGGGGCTGAAGAAATCTCTGGG - Intergenic