ID: 1173804646

View in Genome Browser
Species Human (GRCh38)
Location 20:45916266-45916288
Sequence TTGTGTACCCAGATGAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173804644_1173804646 21 Left 1173804644 20:45916222-45916244 CCAGCAATCAAAGGGATGGGAAA No data
Right 1173804646 20:45916266-45916288 TTGTGTACCCAGATGAATCCAGG No data
1173804643_1173804646 22 Left 1173804643 20:45916221-45916243 CCCAGCAATCAAAGGGATGGGAA No data
Right 1173804646 20:45916266-45916288 TTGTGTACCCAGATGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173804646 Original CRISPR TTGTGTACCCAGATGAATCC AGG Intergenic
No off target data available for this crispr