ID: 1173806218

View in Genome Browser
Species Human (GRCh38)
Location 20:45927080-45927102
Sequence CAGGCTCTGGTTTCTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173806218_1173806228 4 Left 1173806218 20:45927080-45927102 CCCACCACAGAAACCAGAGCCTG No data
Right 1173806228 20:45927107-45927129 AGAAACGGGGATACCTGGCCAGG No data
1173806218_1173806227 -1 Left 1173806218 20:45927080-45927102 CCCACCACAGAAACCAGAGCCTG No data
Right 1173806227 20:45927102-45927124 GGAATAGAAACGGGGATACCTGG No data
1173806218_1173806225 -9 Left 1173806218 20:45927080-45927102 CCCACCACAGAAACCAGAGCCTG No data
Right 1173806225 20:45927094-45927116 CAGAGCCTGGAATAGAAACGGGG No data
1173806218_1173806224 -10 Left 1173806218 20:45927080-45927102 CCCACCACAGAAACCAGAGCCTG No data
Right 1173806224 20:45927093-45927115 CCAGAGCCTGGAATAGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173806218 Original CRISPR CAGGCTCTGGTTTCTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr