ID: 1173808694

View in Genome Browser
Species Human (GRCh38)
Location 20:45942854-45942876
Sequence CTTTGGAAGGCTAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205347
Summary {0: 3, 1: 234, 2: 5941, 3: 59931, 4: 139238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173808694_1173808699 11 Left 1173808694 20:45942854-45942876 CCTTCCACCTTAGCCTTCCAAAG 0: 3
1: 234
2: 5941
3: 59931
4: 139238
Right 1173808699 20:45942888-45942910 CAGATGTGAGCCACTACGCCTGG 0: 10
1: 844
2: 14178
3: 68066
4: 151322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173808694 Original CRISPR CTTTGGAAGGCTAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr