ID: 1173809698

View in Genome Browser
Species Human (GRCh38)
Location 20:45948331-45948353
Sequence CCCACAGTGAGCGAAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173809690_1173809698 8 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1173809690 20:45948300-45948322 CCAAAAGCCAGACTCTTGCTGGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1173809686_1173809698 14 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1173809686 20:45948294-45948316 CCCAACCCAAAAGCCAGACTCTT 0: 1
1: 0
2: 1
3: 16
4: 283
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1173809685_1173809698 15 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1173809685 20:45948293-45948315 CCCCAACCCAAAAGCCAGACTCT 0: 1
1: 0
2: 0
3: 22
4: 247
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1173809688_1173809698 9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1173809688 20:45948299-45948321 CCCAAAAGCCAGACTCTTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1173809687_1173809698 13 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1173809687 20:45948295-45948317 CCAACCCAAAAGCCAGACTCTTG 0: 1
1: 0
2: 1
3: 25
4: 179
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1173809684_1173809698 20 Complete closest: 684
total_pairs: 2
max_distance: 1000
Left 1173809684 20:45948288-45948310 CCTGTCCCCAACCCAAAAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 349
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1173809692_1173809698 1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1173809692 20:45948307-45948329 CCAGACTCTTGCTGGCCCTGGAT 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173809698 Original CRISPR CCCACAGTGAGCGAAGAGCT GGG Intergenic
900014153 1:137330-137352 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
900044016 1:492532-492554 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
900065426 1:727438-727460 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
901107781 1:6770750-6770772 CCCAGATTCAGAGAAGAGCTCGG + Intergenic
905929995 1:41780223-41780245 ACCGCAGTGAGGGGAGAGCTGGG + Intronic
907732962 1:57085754-57085776 CATACAGTGTGCGAGGAGCTGGG - Intronic
908520230 1:64934497-64934519 ACAACAGTGAAGGAAGAGCTTGG + Intronic
912522979 1:110259139-110259161 CCCACAGTAAGCCAAAGGCTGGG + Intronic
915364418 1:155306414-155306436 CCCACACTGAGCAGAGACCTGGG - Intergenic
915521625 1:156448565-156448587 CCCAGAGGGAGGGAAGAGCTAGG + Intergenic
916162296 1:161929787-161929809 CCCACAGTTAGTGAAAGGCTAGG + Intronic
916818060 1:168372360-168372382 GCCACAGTGAGGGAAGACCTGGG + Intergenic
919845709 1:201640866-201640888 CCCACTGTGTGCACAGAGCTGGG + Intronic
920254917 1:204648257-204648279 CCCACAGTGAGAGAGGGCCTGGG + Intronic
920833382 1:209485415-209485437 CCCATGATGAGCGCAGAGCTTGG - Intergenic
922734046 1:227970213-227970235 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
922734437 1:227971752-227971774 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
922734725 1:227972884-227972906 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
923066253 1:230519985-230520007 CCCACACTCAGCAAAGAGCAAGG - Intergenic
924343480 1:243054905-243054927 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
924501681 1:244644136-244644158 CTTACTGTGAGCAAAGAGCTGGG + Intergenic
1064667270 10:17667911-17667933 CCCTGAATGAGCGCAGAGCTGGG + Intronic
1071078406 10:81782036-81782058 CCCACAGGGACCCAAAAGCTTGG + Intergenic
1072830068 10:98648145-98648167 CCCAAAGTGTGCAAAGAGTTAGG - Intronic
1073209077 10:101783654-101783676 CCGACACAGAGCGAGGAGCTTGG - Intergenic
1076652074 10:131996830-131996852 CACACAGAGAGGGCAGAGCTGGG + Intergenic
1076970353 11:129007-129029 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1077052444 11:573395-573417 CTCACAGTGACCTAAGAGGTAGG + Intergenic
1077453360 11:2663976-2663998 CCCAAAGTGGGCAGAGAGCTTGG - Intronic
1079377820 11:19909538-19909560 CCCTCAGTGAGCAAAGACCCTGG + Intronic
1081976079 11:47235649-47235671 CTCACAGTGAGATCAGAGCTGGG - Intronic
1082259861 11:50070641-50070663 ACCACAGTGAGACAGGAGCTGGG + Intergenic
1082259949 11:50071168-50071190 GCCACAGTGAGGCAAGAGCTGGG + Intergenic
1086362020 11:86069206-86069228 CGCTCAGCGAGGGAAGAGCTGGG + Intronic
1089884536 11:121806922-121806944 CCCAGGCTGAGCGAAGAGCATGG + Intergenic
1090358315 11:126155531-126155553 CCCACCGTGAGAGATCAGCTGGG - Intergenic
1091544703 12:1493817-1493839 CCCAGAGTGAGAGAAGAGGAAGG + Exonic
1094318866 12:29163080-29163102 CCCAGAGTGAGGGGAGACCTGGG + Intronic
1094342357 12:29427210-29427232 CCCTGAATGAGGGAAGAGCTTGG - Intronic
1097630207 12:62051618-62051640 CCCACAGTGAGCCAGGCACTAGG + Intronic
1100276789 12:93078925-93078947 CCCAAAGTCAGGGAAGAGCTTGG + Intergenic
1103920885 12:124398637-124398659 CCCACAGTAATAGAAGAGCTGGG - Intronic
1103979872 12:124729866-124729888 CGCTGAGTGAGAGAAGAGCTGGG - Intergenic
1105829229 13:24149599-24149621 ACCACAGTGACAGAAGATCTAGG - Intronic
1108412063 13:50159587-50159609 CTCACAGTGTGAGAAGAACTTGG + Intronic
1111759675 13:92445837-92445859 GCCACAGTGAGCTATGATCTTGG - Intronic
1113441140 13:110329462-110329484 CCCGCAGTGAGGGAAGAGGGTGG - Intronic
1113752167 13:112784008-112784030 CCCACAGTGGGGCAAGAGCCTGG + Intronic
1117262310 14:54048256-54048278 CACACAGTGAGTGACTAGCTAGG + Intergenic
1119996456 14:79258689-79258711 CCAACAATGAGCCAAGAGCTGGG - Intronic
1121781359 14:96624416-96624438 CTCACAGTGAGCACGGAGCTGGG - Intergenic
1121819087 14:96951445-96951467 CCCAGAGGCAGGGAAGAGCTTGG + Intergenic
1122043475 14:99007170-99007192 CCCAGTGTGGGCCAAGAGCTGGG - Intergenic
1122935443 14:104953899-104953921 CCCACAGCGAGGGAAGAGACAGG - Exonic
1128694509 15:69750582-69750604 CCCACAGCCAGCAAAAAGCTGGG - Intergenic
1129163982 15:73765052-73765074 CCCACAGTGTGCAAACAGCCTGG + Intergenic
1131725976 15:95225252-95225274 CACAGAGTGGGCGAAGATCTAGG - Intergenic
1133969805 16:10559370-10559392 GCCACAGTGAGCATGGAGCTGGG - Intronic
1138435876 16:56999869-56999891 CCCACTGGGAGTGGAGAGCTGGG + Intronic
1138678001 16:58665770-58665792 CCCAGAGAGGGCGAAGAGATAGG - Exonic
1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG + Exonic
1142457188 17:63371-63393 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1145905054 17:28511726-28511748 CCCACACCGAGAGCAGAGCTGGG + Intronic
1146693439 17:34892241-34892263 CCCACAGTAAGCGCACAGCCTGG - Intergenic
1147877957 17:43634875-43634897 CCCACGGTGAGAGACGAGTTAGG + Intergenic
1148226408 17:45900756-45900778 CTCACAGTGAGCAGGGAGCTGGG - Intronic
1150561422 17:66298603-66298625 CCCACTGTGACCTAAGAGTTGGG - Intergenic
1151597844 17:75088706-75088728 CCCACCATGGGAGAAGAGCTGGG + Intronic
1152386358 17:79977213-79977235 CCCTCAGTAAGCGAAGAGAAGGG + Intronic
1152563999 17:81092095-81092117 CCCTCAGCGACCCAAGAGCTGGG + Intronic
1152926474 17:83090027-83090049 CTCACAGAGGGCGAAGTGCTAGG + Intronic
1152946122 17:83198566-83198588 CCCACAGTGAGCGAAGAACCAGG + Intergenic
1153251731 18:3129471-3129493 CCCGCACTGAGCGATGAGCCTGG - Exonic
1154976437 18:21461628-21461650 CACACAGTGGGAGAAAAGCTGGG - Intronic
1155798974 18:30076023-30076045 CCAACACTGAGCAAAGACCTGGG - Intergenic
1156485925 18:37465597-37465619 CCCACTGTGTGCCCAGAGCTGGG + Intronic
1157395480 18:47337558-47337580 CCCAGAGAGAGGAAAGAGCTGGG - Intergenic
1158471745 18:57743228-57743250 ACCACAGAGAGCACAGAGCTGGG - Intronic
1160647547 19:200476-200498 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1163795377 19:19334857-19334879 CCCACAGAGTGCGATGAGTTAGG + Intronic
1166027790 19:40104786-40104808 CCCACATTGAGGGAAGTGATTGG + Intergenic
1167304090 19:48696852-48696874 CCCCGGGTGAGCGGAGAGCTGGG + Intronic
1167726302 19:51215460-51215482 CTCACACTGAGTGAAGAGATCGG - Intergenic
925752700 2:7104110-7104132 CCCAAAATGTGCCAAGAGCTTGG - Intergenic
926061067 2:9805440-9805462 CCCACACAGAGCAAGGAGCTCGG + Intergenic
928174105 2:29022664-29022686 CCCACAGTGGGAGGAGCGCTCGG - Intronic
932217439 2:69976024-69976046 CCCTCTGTGAGCTAACAGCTGGG - Intergenic
935363336 2:102266482-102266504 GCCACAGTAAGTGAAGAACTTGG + Intergenic
935671363 2:105559758-105559780 CCGACAGTGAGGGAAGAGAGGGG - Intergenic
938343136 2:130548649-130548671 CCCAGAGTGAGAGATGAGGTAGG + Intronic
938346697 2:130572073-130572095 CCCAGAGTGAGAGATGAGGTAGG - Intronic
940036076 2:149313221-149313243 CCCACATTGTTGGAAGAGCTGGG - Intergenic
948654919 2:239470683-239470705 CCCCCAGGGAGCACAGAGCTGGG + Intergenic
1169961255 20:11162536-11162558 CCCAGAATAAGCGAAGAGCTGGG + Intergenic
1171295991 20:24017712-24017734 CACACACTGAGCTAAGAGCTTGG - Intergenic
1172116651 20:32577028-32577050 CCCACAGTGAACACACAGCTGGG - Intronic
1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG + Intergenic
1175270968 20:57734010-57734032 GCCACAGTGAGAGAGGAGATTGG - Intergenic
1176072680 20:63235205-63235227 CCCACAGTGAGGGAACAGGGAGG - Intergenic
1176108387 20:63400010-63400032 GCCACAGTGAGTGAGGAGCAGGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1183014758 22:34977004-34977026 CACACAGGGAGGGAAGGGCTGGG - Intergenic
1183281523 22:36935138-36935160 CCCACAGTGTTCAAAGTGCTGGG - Intronic
1183617600 22:38954878-38954900 CCCACAGTGATGGCAGAGCCAGG + Intronic
950273960 3:11642807-11642829 CCCACAGGGAGCGGAGCGCGAGG + Intronic
950429136 3:12940947-12940969 CCCACAGTGTGCCTAGGGCTGGG - Intronic
958492955 3:94801439-94801461 GCCAAAGTGAGCCAAAAGCTAGG - Intergenic
960007847 3:112799203-112799225 CCCACACTGAGGGCAGAGCATGG - Intronic
961575646 3:127833880-127833902 CCCACAGTGATTGTAGAGATGGG - Intergenic
962436415 3:135371321-135371343 CCAAGAGTGAGCAAAGAGGTGGG - Intergenic
966866688 3:184262005-184262027 CCCACAGCGCGGGAAGAGCTCGG + Intronic
967227442 3:187305541-187305563 GGCACAGTGAGCGCAGAGCCTGG + Intergenic
968370294 3:198219636-198219658 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
968549917 4:1216876-1216898 CCCACTGTGAGCCAACAGCATGG + Intronic
969117237 4:4878308-4878330 CCCACAGTGATCCAAGAAGTTGG + Intergenic
969426488 4:7127405-7127427 CCCACAGGGTGAGGAGAGCTGGG + Intergenic
973198687 4:47475722-47475744 CTCACAGTAAGCGCAGAGCAAGG - Intergenic
974057164 4:56995747-56995769 CCAACAGCGAGCAAAGACCTGGG - Intronic
975662964 4:76705724-76705746 ACCACTATGAGTGAAGAGCTAGG - Intronic
976831587 4:89320978-89321000 TTCACAGTGGGCGAAAAGCTCGG + Intergenic
984853528 4:184173892-184173914 TCCACAGTGAGTGAGGAGGTGGG + Intronic
986257340 5:6111152-6111174 CCCACTGTGTGCCAAGATCTGGG + Intergenic
995321947 5:110844717-110844739 CCCACAGAGATGGAAGAGCCCGG + Intergenic
996222133 5:120947218-120947240 TCCACAGTGAGGGAAGAGAATGG + Intergenic
999616403 5:153429319-153429341 CCCACACTTAGCATAGAGCTTGG - Intergenic
1001337385 5:170810686-170810708 CCCACCTTGAGCAAAGTGCTAGG + Intronic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002299187 5:178247891-178247913 CCAGCAGTGTGCGATGAGCTCGG - Intronic
1002487481 5:179549636-179549658 CCCACAGTGAGCGGAGATCATGG - Intergenic
1002729827 5:181326397-181326419 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1004692997 6:18008993-18009015 CGCCCAGGGAGTGAAGAGCTGGG + Intergenic
1006451579 6:34108713-34108735 CCCACAGTGTGCCAGGTGCTGGG + Intronic
1006782761 6:36643336-36643358 CCCACGGGGAGCACAGAGCTGGG + Intergenic
1012508857 6:99979292-99979314 CCCTCAGTGAGCAAAGTGCAGGG - Intronic
1017124980 6:151056877-151056899 CCCACTGTGTGCCAAGTGCTAGG - Intronic
1017543345 6:155425769-155425791 CCCACACTGTGAGAGGAGCTGGG - Intronic
1020434066 7:8143468-8143490 CCCTCAGTGAGAGAAAAGCCAGG + Intronic
1022472839 7:30692326-30692348 CCCACACTGACTGGAGAGCTGGG - Intronic
1022531716 7:31070940-31070962 CCCACTGTGAGCTGAGTGCTGGG - Intronic
1023401053 7:39793181-39793203 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1023457782 7:40360458-40360480 CCAACAGTGTGCCAAGCGCTGGG + Intronic
1023999973 7:45183610-45183632 CCTAGAATGAGCAAAGAGCTTGG - Exonic
1024074122 7:45810159-45810181 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1024648582 7:51387598-51387620 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1024649210 7:51390039-51390061 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1024649223 7:51390107-51390129 GCCACAGACAGGGAAGAGCTGGG + Intergenic
1024816156 7:53274565-53274587 CTCACAGTGAGTCAAGGGCTGGG - Intergenic
1025052913 7:55743878-55743900 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1025053290 7:55745369-55745391 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1025176439 7:56804582-56804604 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1025182201 7:56828911-56828933 ACCACCGTGAGGGAGGAGCTGGG + Intergenic
1025182213 7:56828979-56829001 GCCACAGACAGGGAAGAGCTGGG + Intergenic
1025689717 7:63748016-63748038 GCCACAGACAGGGAAGAGCTGGG - Intergenic
1025689729 7:63748084-63748106 ACCACTGTGAGGGAGGAGCTTGG - Intergenic
1025695352 7:63771804-63771826 GCCACTGTGAGGGAGGAGCTGGG + Intergenic
1025912835 7:65841460-65841482 GCTACAGTGAGGCAAGAGCTGGG - Intergenic
1026454429 7:70558348-70558370 CACAGAGAGAGAGAAGAGCTGGG - Intronic
1029217578 7:98962416-98962438 CACACACTCACCGAAGAGCTGGG - Exonic
1030297722 7:107945649-107945671 CCCAAAGTGAGGAAAGAACTGGG - Intronic
1032051543 7:128653518-128653540 GCCACCGTGAGAGAGGAGCTGGG - Intergenic
1033153446 7:138936535-138936557 CCCAGAGTGAGCGAAGAAGCAGG - Intronic
1033241332 7:139682285-139682307 CCCATAGTGAGTCAAGACCTGGG + Intronic
1034015937 7:147586508-147586530 CCCACAGAGAGAGAAGAGGAAGG + Intronic
1035898497 8:3431861-3431883 CCCACAGTGAGATAAGATATCGG + Intronic
1037907869 8:22726046-22726068 CTCAGAGTGAGAGCAGAGCTGGG + Intronic
1039023143 8:33229322-33229344 CCCAAAGAGAGCGAACAGATGGG - Intergenic
1039121185 8:34148489-34148511 CCCACAGTCAGCGTATAGTTGGG - Intergenic
1039260953 8:35771247-35771269 CCCACAGTGAAGAGAGAGCTCGG + Intronic
1040551502 8:48440970-48440992 GCCACAGTCAGAGCAGAGCTGGG - Intergenic
1041963444 8:63647088-63647110 CTCACAGTGATCACAGAGCTGGG - Intergenic
1047258202 8:123232683-123232705 CCCACATTGAGTGAAAAGATAGG + Intronic
1048209811 8:132445393-132445415 CCCACAGTGAACGCAGAGTCTGG - Intronic
1048304525 8:133274281-133274303 CACACACTGAGCCCAGAGCTCGG - Intronic
1048360986 8:133697010-133697032 CCCGCAGGGAGCATAGAGCTGGG - Intergenic
1049039655 8:140102856-140102878 CCCCCACTGAGCGAGGGGCTGGG + Intronic
1049353404 8:142176118-142176140 CCCACAATGAGAGAAGTGATTGG - Intergenic
1049462260 8:142735651-142735673 CCCACCTTGAGGGCAGAGCTGGG - Exonic
1049778703 8:144417839-144417861 CCCACAGAGAGGGCAGGGCTGGG - Intergenic
1051484588 9:17594303-17594325 TCCACAGAGAGGGAAGAGCATGG - Intronic
1057867263 9:98691465-98691487 CCCCCAGTCAACGGAGAGCTGGG - Intronic
1061450796 9:130666030-130666052 CACACAGCGAGCGCAGAGCCTGG + Intronic
1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG + Intronic
1062754239 9:138278909-138278931 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1203577799 Un_KI270745v1:21666-21688 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1186482855 X:9909424-9909446 CCCACACTGAGCGGGGAGCGGGG - Intronic
1187181457 X:16946977-16946999 GGCACAGCGCGCGAAGAGCTCGG - Exonic
1190219692 X:48503876-48503898 CCCATTGTGAGCCAACAGCTGGG + Intergenic
1190747648 X:53334572-53334594 CCCAGGGTGAGAGATGAGCTTGG + Intergenic
1197648514 X:129041650-129041672 CCCACACTGAGCGCAGGGCCTGG - Intergenic
1200950786 Y:8897722-8897744 TCCAAAGTGAGCAAAGAGTTGGG - Intergenic