ID: 1173810194

View in Genome Browser
Species Human (GRCh38)
Location 20:45950698-45950720
Sequence CACAGGATTTTGGTTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173810194_1173810200 12 Left 1173810194 20:45950698-45950720 CCTGGGAAAACCAAAATCCTGTG 0: 1
1: 0
2: 0
3: 21
4: 281
Right 1173810200 20:45950733-45950755 GCTGGGTAGAAAGGCCAAGCCGG 0: 1
1: 0
2: 2
3: 14
4: 161
1173810194_1173810201 24 Left 1173810194 20:45950698-45950720 CCTGGGAAAACCAAAATCCTGTG 0: 1
1: 0
2: 0
3: 21
4: 281
Right 1173810201 20:45950745-45950767 GGCCAAGCCGGATCCGTATCTGG 0: 1
1: 0
2: 0
3: 0
4: 21
1173810194_1173810197 -6 Left 1173810194 20:45950698-45950720 CCTGGGAAAACCAAAATCCTGTG 0: 1
1: 0
2: 0
3: 21
4: 281
Right 1173810197 20:45950715-45950737 CCTGTGCACTAACAAGAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 111
1173810194_1173810199 3 Left 1173810194 20:45950698-45950720 CCTGGGAAAACCAAAATCCTGTG 0: 1
1: 0
2: 0
3: 21
4: 281
Right 1173810199 20:45950724-45950746 TAACAAGAAGCTGGGTAGAAAGG 0: 1
1: 0
2: 0
3: 20
4: 275
1173810194_1173810198 -5 Left 1173810194 20:45950698-45950720 CCTGGGAAAACCAAAATCCTGTG 0: 1
1: 0
2: 0
3: 21
4: 281
Right 1173810198 20:45950716-45950738 CTGTGCACTAACAAGAAGCTGGG 0: 1
1: 0
2: 1
3: 4
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173810194 Original CRISPR CACAGGATTTTGGTTTTCCC AGG (reversed) Intronic
902832113 1:19022185-19022207 CCCAGGCTTTTCATTTTCCCTGG - Intergenic
904819600 1:33233188-33233210 TAAAGGATTTTGGTCTGCCCAGG - Intergenic
905706298 1:40062031-40062053 CATAGGACTGTGGTTATCCCTGG + Intronic
906015976 1:42579998-42580020 TTCAGGATATTGGTTTTCTCTGG + Intronic
906918357 1:50036145-50036167 CACATGATTTTGGTCATCTCTGG - Intergenic
911799632 1:102120212-102120234 AACAGGATATTGGTTATCTCTGG + Intergenic
914774912 1:150728058-150728080 CAAAGGACTCTGGTTTTCCTAGG + Intergenic
917436008 1:175022238-175022260 CACAGTATTTTGGATATACCTGG + Intronic
917810311 1:178652053-178652075 CACAGGAAATGTGTTTTCCCAGG + Intergenic
918357033 1:183714582-183714604 CACAGGGCTTTGGTTTCCTCAGG - Intronic
918770762 1:188556706-188556728 CTCAGCATTTTGGTTTGCCAAGG + Intergenic
919540140 1:198835621-198835643 CAGGGGATTTTGGTATTCCTTGG + Intergenic
920218763 1:204379965-204379987 CACAGGCTGTTTCTTTTCCCAGG - Intergenic
921087623 1:211810912-211810934 AACAGGAATTTTGTATTCCCTGG - Intronic
922862750 1:228833307-228833329 CATAGGATTTTGTTTTTCCTGGG - Intergenic
923335175 1:232962723-232962745 CAAACTATGTTGGTTTTCCCTGG - Intronic
1063264236 10:4429307-4429329 CACAGTATTTTGATTTTTCATGG + Intergenic
1063440546 10:6069444-6069466 TAGTGGATTTTGGTTTTCCACGG - Intergenic
1066321641 10:34308783-34308805 CACAGAATTTTGATATTCTCAGG - Intronic
1067757558 10:49016445-49016467 CCCAGGATTTTGATATTCCAGGG + Exonic
1069363187 10:67668108-67668130 CAATGGTTTTTGGTTTTCGCAGG + Intronic
1069414278 10:68184399-68184421 CACAGGATCTGGGTTTACTCTGG - Intronic
1069796045 10:71052620-71052642 CACAGGCTGTGGGTCTTCCCAGG + Intergenic
1069860146 10:71465707-71465729 CACAGGGTTGTTTTTTTCCCAGG - Intronic
1070441514 10:76450734-76450756 CATTGGATTTTGGGTTTCCTAGG + Intronic
1070719216 10:78744860-78744882 CACTGGATGTGGGCTTTCCCAGG + Intergenic
1073086756 10:100895974-100895996 CACAGGAGTTCTGTTCTCCCAGG + Intergenic
1075490507 10:122863899-122863921 AAAAGGACTTTGGTCTTCCCTGG + Intronic
1075502828 10:122993094-122993116 CACTGGATTTTTATTTTCACAGG - Exonic
1075850765 10:125585104-125585126 CACAGCATTTGTGTTTTTCCTGG - Intronic
1076502093 10:130945391-130945413 CTCAGGCTTTTGGTTTTTCCTGG - Intergenic
1076858676 10:133129486-133129508 CACAGTAGTTTCGTTTTTCCAGG - Exonic
1077130818 11:971556-971578 CACAGGACTGGGGTTTGCCCTGG + Intronic
1080749371 11:35138718-35138740 CACAGGATGTTGGATATCCTGGG - Intergenic
1081768124 11:45626877-45626899 AACAGAGTTTTGGTATTCCCAGG + Intergenic
1083647933 11:64183920-64183942 GACATGATTTTAGTTTTCTCAGG - Intergenic
1083866624 11:65458123-65458145 CACAGGACTTTGCCTTTCCCTGG + Intergenic
1086231797 11:84578522-84578544 CACTGGATTTTGGATTTGCATGG + Intronic
1086362209 11:86070364-86070386 CACAGTATTTTGGATTTGGCTGG - Intergenic
1086791766 11:91048624-91048646 CCCAGGAATTTGCTTTTCCTTGG - Intergenic
1086894847 11:92300233-92300255 CTCAAGATTTTGTTTTTGCCAGG + Intergenic
1087582346 11:100073759-100073781 CACAGGATTGTCTTTTTCGCAGG + Intronic
1090450770 11:126804179-126804201 CACAGGTTTTTGGTTTCATCAGG - Intronic
1091320766 11:134647700-134647722 CACAGGCCTTTGGTTTCTCCAGG + Intergenic
1091841397 12:3623859-3623881 CAAAGGATTTTGGTTCCCTCTGG + Intronic
1095113726 12:38329849-38329871 CACAGGTCTCTGGTTTTCCTAGG + Intergenic
1097999181 12:65922416-65922438 CACAGGATTTCGGACTTCCATGG + Intronic
1098849113 12:75573545-75573567 AACATGATTTTGGTTTTCCTTGG + Intergenic
1098901921 12:76119473-76119495 CACAGGAAGTTGCTTCTCCCTGG - Intergenic
1101480550 12:105092534-105092556 CACAGGAGATTGGTTTGACCAGG - Intergenic
1102656172 12:114484370-114484392 CAAAGGTCTCTGGTTTTCCCAGG + Intergenic
1102910582 12:116710757-116710779 CCCAGGCTTTTGATTTTCACAGG - Exonic
1103699158 12:122839532-122839554 GACAGGATTTTGGTTTCACGGGG - Intronic
1105246663 13:18658670-18658692 CACAAGAGATTGGTTTTGCCTGG + Intergenic
1107171130 13:37342567-37342589 CTCAGGGTGTTGCTTTTCCCTGG - Intergenic
1107499266 13:40956456-40956478 CAAAGGTCTTTGGTTTTCCTAGG - Intronic
1109676443 13:65681330-65681352 CTCATTATTTTAGTTTTCCCTGG - Intergenic
1111268374 13:85849817-85849839 CACTGGATTTTGGATTTGCATGG - Intergenic
1111404510 13:87785178-87785200 CCCAGGATTTTGGCTGTCCAAGG - Intergenic
1111687152 13:91516375-91516397 CACAGGATTTTGGACTTGCATGG - Intronic
1113067638 13:106388083-106388105 ACCAGGATTCTGGTTTTCCTAGG + Intergenic
1113308164 13:109100972-109100994 CAAAGGAATTTGTTTTTGCCAGG - Intronic
1113645367 13:111991178-111991200 CACTGGATTTTGGATTTGCATGG + Intergenic
1114400504 14:22405973-22405995 CACAAGATTCTGGGTTTCCATGG - Intergenic
1114528532 14:23380988-23381010 AACAGGATTTTGTGTTTCTCTGG + Intergenic
1114557759 14:23571544-23571566 CCCAGGACTTTGGAATTCCCAGG + Intronic
1114986031 14:28230310-28230332 CACTGGATTTTGGATTTGCACGG - Intergenic
1115085714 14:29512842-29512864 CACTGGATTTTGGATTTGCATGG - Intergenic
1115854647 14:37617876-37617898 AACAAGATTTGGGTTTTCCTAGG - Intronic
1117061448 14:51967664-51967686 CAAAGCATTTTGGTTTATCCAGG + Exonic
1117518220 14:56523756-56523778 CACAGGAATTTTGTTTTGCTGGG + Intronic
1121881695 14:97506657-97506679 CACAGGATTTTGATTTTGGGAGG + Intergenic
1122276862 14:100595077-100595099 CACAGGATCCTGGTTGTGCCTGG - Intergenic
1122401084 14:101467828-101467850 TACAGGCCTTTGGTTTTCCCCGG - Intergenic
1122475905 14:102008867-102008889 CTCAGGTTTTTGGTTGTCCTAGG - Intronic
1125729108 15:41882826-41882848 GACAGGATTTTTCTTTTCCCTGG + Intronic
1125863047 15:43015527-43015549 CAAAGGTCTTTGGTTTTCCTAGG - Intronic
1127769502 15:62219490-62219512 CACAGGTCTCTGGTTTTCCTAGG - Intergenic
1128174921 15:65546817-65546839 CACAGAGTTTTGGGGTTCCCCGG + Intronic
1129277307 15:74454711-74454733 TACAGGATTTTGGTTTTGTCTGG + Intronic
1129751464 15:78067735-78067757 CACTGGATTCTAGTTCTCCCAGG + Intronic
1130705221 15:86226617-86226639 CACTGGCTATTGGTTTTTCCTGG - Intronic
1130857323 15:87852223-87852245 GACAGGATGCTGCTTTTCCCAGG - Intergenic
1133633116 16:7640659-7640681 CACAGGACTTGGGGTTTCCAGGG - Intronic
1133978381 16:10616708-10616730 CTGAGGATTTTTGATTTCCCGGG + Intergenic
1136611389 16:31368717-31368739 CAAAGGTCTCTGGTTTTCCCAGG + Intronic
1137461892 16:48672137-48672159 GGTAGAATTTTGGTTTTCCCGGG - Intergenic
1138615956 16:58167046-58167068 CACAGAATTTTGTGTTTACCAGG - Intronic
1139098110 16:63730487-63730509 CCCATGATTTTAGTTTCCCCTGG - Intergenic
1140122535 16:72096135-72096157 CACAGGATCTGGGATTTCTCTGG - Exonic
1141428645 16:83959464-83959486 CACACACTTTTGTTTTTCCCTGG - Intronic
1144123211 17:12177187-12177209 TACAAGATGTTGGTTTTCTCTGG + Intergenic
1144202186 17:12951668-12951690 AACAGGTTCTTGTTTTTCCCTGG - Intronic
1144404318 17:14938102-14938124 CTTAGAATCTTGGTTTTCCCAGG - Intergenic
1145787219 17:27602151-27602173 CACAGTATTTTGGTTACTCCAGG + Intronic
1146516114 17:33490858-33490880 GACAGAATTTTGATTATCCCCGG - Intronic
1146539289 17:33680564-33680586 CAAAGGATTTTCCTTTCCCCAGG + Intronic
1148008141 17:44451628-44451650 TACAGTATTTTCTTTTTCCCTGG + Intronic
1149062460 17:52438895-52438917 CACAGGGGTTTGGTGTGCCCAGG + Intergenic
1149866233 17:60152501-60152523 CTTAGGAATTTGGTCTTCCCTGG - Intronic
1150380718 17:64717235-64717257 CAAAGGTCTTTGGTTTTCCTAGG - Intergenic
1151123118 17:71814982-71815004 CACAGGTTGTTGGTTATGCCCGG + Intergenic
1151133087 17:71918630-71918652 CACTGGATTTTGGTGTTCCAGGG + Intergenic
1153132988 18:1878946-1878968 CACAAAATTTTTGGTTTCCCAGG + Intergenic
1153341916 18:3984259-3984281 CAAGGGATTTTGGTTTTCTTAGG - Intronic
1153760589 18:8327643-8327665 CCCAGGATTTTGGCTTTGCCGGG - Intronic
1154442196 18:14400453-14400475 CACAAGAGATTGGTTTTGCCTGG - Intergenic
1156182604 18:34623064-34623086 CACAGCATGTTTGTTATCCCAGG - Intronic
1156963111 18:43056949-43056971 CATGGGATTTTTCTTTTCCCTGG + Intronic
1157003021 18:43549975-43549997 CACCGGATTTTGGATTTGCATGG - Intergenic
1158864728 18:61627363-61627385 GACAGGATGTTCCTTTTCCCGGG + Intergenic
1159419590 18:68200091-68200113 CAAAGGATATTTGTTTTTCCTGG + Intergenic
1159676633 18:71291908-71291930 TATAGGATTTTGCTTTTCTCAGG - Intergenic
1159731568 18:72034234-72034256 CACAGGATTTTGGACTTGCATGG - Intergenic
1160046454 18:75391357-75391379 CACAGGGTCTTAGTTTTCACTGG + Intergenic
1160217372 18:76944285-76944307 TACAGGAATTTGCATTTCCCTGG - Intronic
1163128889 19:15259654-15259676 CACTGGCTTGTGGGTTTCCCAGG - Intronic
1163216349 19:15880150-15880172 CCCAGGATTTTGGTTTGAGCAGG - Intronic
1164141073 19:22464028-22464050 TACAGGAATCTGGTCTTCCCAGG + Intronic
1165351439 19:35278040-35278062 CATAGGATTTGGGTCTTTCCTGG + Intronic
1165358304 19:35317763-35317785 CACTCGATTTTGGCCTTCCCTGG - Intergenic
1167874600 19:52401148-52401170 CACAGGATTTTGGAATTCAGGGG - Intronic
925743557 2:7026678-7026700 GACAGAAGTTTGGTTTCCCCAGG + Intronic
927274440 2:21250624-21250646 CATAGTACTTCGGTTTTCCCAGG + Intergenic
928889080 2:36181045-36181067 CACAGGTCTCTGGTTTTCCTAGG - Intergenic
929275852 2:40023763-40023785 CACGGGATATTTGTTTTACCTGG - Intergenic
929309899 2:40410498-40410520 CTCACAATTTTGTTTTTCCCCGG - Intronic
933061904 2:77748115-77748137 GACAGAATTTTGCTTTTCCTAGG - Intergenic
934746678 2:96763916-96763938 CCCAGGAATCAGGTTTTCCCAGG + Intronic
934998371 2:98988290-98988312 CAAAGGACTCTGGTTTTCCTAGG + Intergenic
935109455 2:100078730-100078752 CCTAGGATTTTGGTATCCCCAGG - Intronic
935425720 2:102916728-102916750 CACTGGATTTTGGATTTGCATGG - Intergenic
937470796 2:122172376-122172398 CACAGTTTTTTGGGGTTCCCAGG - Intergenic
938662464 2:133501907-133501929 CACATGATTTAGGAATTCCCAGG - Intronic
939625079 2:144467085-144467107 CTCAAGATTTTGGTTTTCTATGG + Intronic
943245914 2:185450916-185450938 CACTGGATTTTGGACTTCCATGG - Intergenic
943446007 2:187988638-187988660 CCCAGGGTTTTGGTTTGACCAGG - Intergenic
943804975 2:192112379-192112401 CACTGGATTTTGGATTTGCGTGG + Intronic
945530939 2:210951472-210951494 CACAGGTCTCTGGTTTTCCTAGG - Intergenic
946280150 2:218660641-218660663 GACAGGATTTTTGTGGTCCCTGG - Intronic
947901187 2:233723640-233723662 CAAAGGTCTCTGGTTTTCCCAGG + Intronic
1168983047 20:2024314-2024336 GACAGGATTTTGGTTCTGCTGGG - Intergenic
1169125902 20:3126392-3126414 CAAAGGTCTTTGGTTTTCCTAGG - Intronic
1171970143 20:31559402-31559424 CCCAGGATTTTGCTTTGGCCTGG - Intronic
1172509980 20:35493789-35493811 CACAGAGTTTTTGTTTTCCCTGG + Intronic
1173810194 20:45950698-45950720 CACAGGATTTTGGTTTTCCCAGG - Intronic
1174156509 20:48518957-48518979 CACAGGATTTTGCCTTGCCCAGG + Intergenic
1174730421 20:52910686-52910708 CTCAGGCTTTTTGTTTTGCCAGG + Intergenic
1174774469 20:53331445-53331467 ATCAGGATTTTGGTTCCCCCTGG - Intronic
1175455511 20:59109646-59109668 CTCAGGATTTTGGCTTTGACTGG + Intergenic
1176910783 21:14562063-14562085 CATAGTATATTGGTTTTCCAAGG - Intronic
1179309168 21:40181655-40181677 GACAGGATTTTGATATTTCCGGG + Intronic
1179346510 21:40562722-40562744 TACAGGGCTTTGGCTTTCCCAGG - Intronic
1180739126 22:18041022-18041044 CAAAGGTCTCTGGTTTTCCCAGG + Intergenic
1182914232 22:34013494-34013516 CCCAGAATTTTGGTATCCCCGGG - Intergenic
949798329 3:7875844-7875866 CAGTGGATTTTGGTATTCACAGG + Intergenic
950253492 3:11486944-11486966 CAAAGGTCTTTGGTTTTCCTAGG + Intronic
951453756 3:22867881-22867903 CACTGGCTAATGGTTTTCCCAGG - Intergenic
954867693 3:53743867-53743889 CAGAGGTTTTTGGTCTTCCTAGG - Intronic
955069304 3:55559076-55559098 AACTGGGTATTGGTTTTCCCTGG + Intronic
955879549 3:63529169-63529191 TGGAGGATTTTGGTTTCCCCAGG - Intronic
956475028 3:69610489-69610511 CACTGGATTTTGGATTTGCATGG + Intergenic
957639087 3:82827064-82827086 CACAGGAATATGGGTGTCCCAGG + Intergenic
957678157 3:83397095-83397117 CCTAGGATTTTTGTTTTCCTTGG - Intergenic
958582463 3:96044644-96044666 CACTGGATTTTGGATTTGCATGG - Intergenic
959172444 3:102859657-102859679 CACGGGATTTTGGACTTCCATGG - Intergenic
959608218 3:108265131-108265153 CAAAGGATCTTGGATTTCTCAGG + Intergenic
959915937 3:111816498-111816520 CACTGGATTTTGGTCTTGCATGG + Intronic
960521644 3:118662131-118662153 CACAGGATCTTTCTTTTGCCTGG + Intergenic
961939747 3:130624776-130624798 CAGAGGATTTGGGTTTTCTTTGG - Intronic
961959171 3:130836136-130836158 GTCAGGATTTTGGTTATCCTTGG + Intergenic
963529606 3:146457923-146457945 CCTAGGATTTTGGTATTCACAGG - Intronic
964160513 3:153640391-153640413 CACAGTATTTGGGTATTTCCCGG - Intergenic
964554659 3:157923039-157923061 CACAGGATTTTGTCTTTGCAAGG - Intergenic
965066707 3:163858506-163858528 CACTGGATTTTGGTCTTGCATGG + Intergenic
967537488 3:190623699-190623721 CACAGGGCTTTGGTTTGCCAAGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969799438 4:9551276-9551298 CACATGATTCTGATGTTCCCAGG - Intergenic
970045114 4:11843619-11843641 CACATCATCTTGGTTTGCCCGGG + Intergenic
970941285 4:21637081-21637103 CCCAGGATTTTGGTATCCCAAGG - Intronic
971449600 4:26787678-26787700 CACGAGATTTGGCTTTTCCCTGG + Intergenic
971564358 4:28118525-28118547 CTCAGGTTTTTGTTTTTCCCTGG + Intergenic
972143715 4:35994862-35994884 CACAAGATTTTGGTTTTCATAGG + Intronic
972184127 4:36507510-36507532 CATAGGAATTTGGGTTTCCTTGG + Intergenic
972654295 4:41050002-41050024 CACAGGTCTCTGGTTTTCCTAGG - Intronic
973053215 4:45620640-45620662 AATAGGATTCTGGTTTTGCCAGG - Intergenic
974041695 4:56863335-56863357 CACTGGATGTGGGCTTTCCCTGG - Intergenic
974719406 4:65717517-65717539 AACAGAATTATGGTTTTCTCTGG + Intergenic
975332048 4:73127223-73127245 CAAATCATTTTGGTTTTCCTGGG - Intronic
976003688 4:80401982-80402004 CACTGGATTTTGGATTTGCACGG + Intronic
979125757 4:116969763-116969785 CCCAGGAATTTGCTTCTCCCTGG + Intergenic
979474780 4:121142263-121142285 TTCTGGATTTTAGTTTTCCCTGG - Intronic
981570825 4:146148788-146148810 CCCAGGAGATGGGTTTTCCCAGG + Intergenic
982042139 4:151407778-151407800 CACCTGATTTTGGTTATCTCTGG + Intergenic
982618836 4:157678085-157678107 CACTGGATTTTGGACTTCCATGG - Intergenic
983766420 4:171489879-171489901 CACTGGATTTTGGTCTTGCATGG + Intergenic
983968604 4:173844149-173844171 CACTGGATTTTGGACTTGCCTGG + Intergenic
984357200 4:178677100-178677122 TACATGCTTTTGGTTTTCCTGGG - Intergenic
984668506 4:182454880-182454902 TACAAGATTTTTGTTTTCCTAGG + Intronic
985205626 4:187532440-187532462 CCCAGGATTTTGGTGTCCCTAGG + Intergenic
986731381 5:10637173-10637195 CACTCCATTTTGGTTTTCCATGG + Intronic
987655534 5:20800816-20800838 CACTGGATTTTGGTCTTGCATGG + Intergenic
987901797 5:24022757-24022779 CACAGTTTTTTGGTTGTCTCAGG - Intronic
988768022 5:34403077-34403099 CACTGGATTTTGGTCTTGCATGG - Intergenic
989183700 5:38602883-38602905 CCCAGGAAGTTGTTTTTCCCAGG - Intronic
989644515 5:43615597-43615619 CTCAGTATTTTGTATTTCCCAGG + Intronic
991323034 5:65397624-65397646 CCCAGGATTTTGGTAGGCCCAGG + Intronic
991327007 5:65445244-65445266 AACAGGATTATGGTTATCTCAGG - Intronic
991590274 5:68244086-68244108 AACAGAATTCTGGTTTGCCCTGG - Intronic
994608881 5:102010076-102010098 TACAGGAATTTTGTATTCCCAGG + Intergenic
995053255 5:107730678-107730700 CAGAGGATTTTGTTTATCCTGGG + Intergenic
996054262 5:118965821-118965843 CAAAGGTTTCTGGTTTTCCTAGG - Intronic
997093041 5:130878995-130879017 CACTGGATTTTGGATTTGCATGG + Intergenic
997491806 5:134283924-134283946 CACTGGATTTTGGATTTGCATGG - Intergenic
998060205 5:139113181-139113203 CAAAGGTTTCTGGTTTTCCTAGG - Intronic
998700829 5:144697837-144697859 AACAACATTTTGATTTTCCCTGG + Intergenic
1000863684 5:166486817-166486839 CTGAGGATTTTTGTTTTCTCTGG + Intergenic
1000991301 5:167914759-167914781 CAGAGATTTTTGGTGTTCCCTGG + Intronic
1001018826 5:168165546-168165568 TTCAGGATTTTGGTTTTGGCCGG - Intronic
1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG + Intronic
1007248486 6:40479597-40479619 CTCAGGATTATGCTTCTCCCAGG - Intronic
1009622542 6:66096257-66096279 CACAGGTCTCTGGTTTTCCTAGG + Intergenic
1010539076 6:77069261-77069283 CACTGGATTTTGGATTTTCATGG - Intergenic
1011122154 6:83965410-83965432 CACTGGATTTTGGACTTCCATGG + Exonic
1011351563 6:86429485-86429507 CACAGGATTAAAGTGTTCCCAGG - Intergenic
1011827964 6:91332695-91332717 TAGAGAATTTTGGATTTCCCAGG - Intergenic
1012240005 6:96860640-96860662 CACTGGATTTTGGATTTGCATGG + Intergenic
1013783851 6:113757490-113757512 CACACGATTTTGCTTATCCCAGG - Intergenic
1014568232 6:122977492-122977514 CCCAGGAAGTTGCTTTTCCCTGG - Intergenic
1015451605 6:133374680-133374702 AACACGGTTTTGGTTTTGCCAGG + Intronic
1016814465 6:148290757-148290779 CAAAGGTCTCTGGTTTTCCCAGG - Intronic
1018511215 6:164526561-164526583 CACTGGATTTTGGACTTCCATGG + Intergenic
1018941829 6:168313607-168313629 CACAGGAATTTTCTTTTTCCTGG + Intronic
1021270048 7:18574499-18574521 CCCAGGATTTTGGCTGTCCCTGG + Intronic
1021952301 7:25786981-25787003 GAAAGGATTTTGTTTTTCTCTGG + Intergenic
1022289199 7:28984987-28985009 CACAGGATATTGGTCTTCAAAGG + Intergenic
1022318338 7:29264696-29264718 CAAAGGTCTCTGGTTTTCCCAGG - Intronic
1024186058 7:46949156-46949178 CATAACATTTTGGTTTTCTCTGG + Intergenic
1025191534 7:56899312-56899334 ATCAGGATTTTTGTTTTTCCTGG + Intergenic
1025680414 7:63677622-63677644 ATCAGGATTTTTGTTTTTCCCGG - Intergenic
1025849587 7:65235200-65235222 CCCAGGAAGTTGCTTTTCCCTGG - Intergenic
1026635404 7:72077623-72077645 CAAAGGAGTCTTGTTTTCCCTGG + Intronic
1027045600 7:74989280-74989302 GACAGGATCTTGCTTTGCCCAGG + Intronic
1027373631 7:77533014-77533036 CAAAGGTCTTTGGTTTTCCTAGG + Intergenic
1028487960 7:91380589-91380611 CACAGGACTTTTGTGTTCCGTGG + Intergenic
1029668111 7:102008847-102008869 ATCAGGATTTTTGTTTTTCCTGG + Intronic
1030652321 7:112128799-112128821 CAAAGGTCTCTGGTTTTCCCAGG - Intronic
1031211279 7:118830470-118830492 CATGAGATTATGGTTTTCCCAGG - Intergenic
1034718295 7:153263995-153264017 CACCGGATTTTGGATTTGCATGG - Intergenic
1038213426 8:25540551-25540573 CACAGGATGTTGATTGTACCTGG + Intergenic
1038380160 8:27085308-27085330 CACAGAATACTGGTTTTCCCAGG - Intergenic
1039173716 8:34780049-34780071 GACAGTTTTTTGGTTTGCCCAGG - Intergenic
1039254930 8:35708689-35708711 AAAAGGATTTAGCTTTTCCCTGG + Intronic
1040917967 8:52583373-52583395 CACAGAATTTTTTTTTTTCCAGG - Intergenic
1042290567 8:67166834-67166856 CACAGGTCTCTGGTTTTCCTAGG + Intronic
1042776803 8:72440987-72441009 CAAAGGAATATGATTTTCCCAGG + Intergenic
1043769866 8:84184582-84184604 GAACGGACTTTGGTTTTCCCTGG - Intronic
1043930296 8:86082830-86082852 CACAGCTTTTTGGCTTTCGCAGG - Intronic
1044481417 8:92693680-92693702 CACAGGATTCTGGTTTTGTTAGG + Intergenic
1045010168 8:97951835-97951857 AACAAGATTTTGGTTTTCCTCGG - Intronic
1047025200 8:120816112-120816134 CACTGGATTTTCCTTCTCCCTGG - Intergenic
1048772701 8:137912557-137912579 CACTGGATTTTGGATTTGCATGG - Intergenic
1049469561 8:142769308-142769330 CAGAGGGACTTGGTTTTCCCAGG + Intronic
1050156070 9:2667408-2667430 CACTGGATTTTGGATTTGCATGG + Intergenic
1050297865 9:4224459-4224481 CACAAGATAGTGATTTTCCCAGG - Intronic
1052123229 9:24743741-24743763 GACAGGATTTTAGTATTTCCAGG + Intergenic
1052270690 9:26625412-26625434 CACTGGAGTTGGGGTTTCCCTGG - Intergenic
1052705334 9:31988175-31988197 CACTGGATTTTGGATTTGCATGG - Intergenic
1055080732 9:72265753-72265775 CACAGGATTTTGGACTTGCATGG - Intergenic
1055253649 9:74339020-74339042 CACAGGAAGTTGCTTCTCCCTGG + Intergenic
1055518762 9:77060263-77060285 CAAAGGTCTCTGGTTTTCCCAGG + Intergenic
1056152952 9:83805351-83805373 CAAAGGTTTCTGGTTTTCCTAGG - Intronic
1057232043 9:93327726-93327748 CACAGTATTTGTGTTTTCCTAGG + Intronic
1057674693 9:97129848-97129870 CAAAGGACTCTGGTTTTCCTAGG + Intergenic
1058360703 9:104143111-104143133 CACTGGAATTTGGATTTCACAGG - Intergenic
1058496279 9:105562506-105562528 CACAGGATTTATATTTTCCCTGG - Intronic
1058825043 9:108767823-108767845 CACAGGTGTATGGTATTCCCAGG - Intergenic
1059601492 9:115783770-115783792 CACAGGATTTTGGACTTGCATGG + Intergenic
1060311336 9:122465262-122465284 CACCGGATTTTTGTTTTACTTGG - Intergenic
1060778560 9:126394715-126394737 GACAGGATTGTGGTTTTACATGG + Intronic
1186559576 X:10596799-10596821 AACAGGGTTTTGGTGTCCCCAGG - Intronic
1188052902 X:25509054-25509076 CACTGGATTTTGGATTTACATGG - Intergenic
1190193800 X:48299653-48299675 CAGAGGTAGTTGGTTTTCCCGGG + Intergenic
1190196545 X:48324157-48324179 CAGAGGTATTTGCTTTTCCCGGG - Intergenic
1190199667 X:48350008-48350030 CAGAGGTAGTTGGTTTTCCCGGG + Exonic
1190666439 X:52700464-52700486 CAGAGGTAGTTGGTTTTCCCGGG + Exonic
1190672979 X:52757946-52757968 CAGAGGTAGTTGGTTTTCCCGGG - Exonic
1192398437 X:70809287-70809309 CACAAAAGTTTGTTTTTCCCTGG - Intronic
1192969522 X:76217263-76217285 CAAAGGACTCTGGTTTTCCTAGG + Intergenic
1193047278 X:77066552-77066574 CAAAGGTCTCTGGTTTTCCCAGG - Intergenic
1193136914 X:77982653-77982675 CATAGAATTTTAGTTTTCCAAGG + Intronic
1194888537 X:99348809-99348831 CAGGGGATTTTCCTTTTCCCAGG + Intergenic
1195368410 X:104149388-104149410 CCCAGCCTTCTGGTTTTCCCAGG - Intronic
1195970159 X:110464066-110464088 CACAGTATATTGTTTTCCCCAGG - Intergenic
1197453650 X:126649597-126649619 CACAGGATATTGGATTTCCAGGG + Intergenic
1197555307 X:127946027-127946049 CTCAGGAATTTGCTTCTCCCTGG + Intergenic
1198748171 X:139911746-139911768 CACAGGATTTTTTATTTTCCTGG - Intronic
1199749393 X:150800596-150800618 CAAAGGATTTTGGTATTTGCAGG + Intronic
1200034134 X:153317501-153317523 GACAGGATGTTGGTTTTCATGGG - Intergenic
1201504771 Y:14686039-14686061 CACAGGAGTTGGGTATTCCTTGG - Intronic
1201753587 Y:17461646-17461668 CACAGGATTTTGGGTGTCTCAGG + Intergenic
1201847966 Y:18444337-18444359 CACAGGATTTTGGGTGTCTCAGG - Intergenic
1202061730 Y:20896234-20896256 CTCAGGATATTGGTTTAACCAGG - Intergenic