ID: 1173813892

View in Genome Browser
Species Human (GRCh38)
Location 20:45972495-45972517
Sequence GTGGGGGGCGTGGCTCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173813880_1173813892 4 Left 1173813880 20:45972468-45972490 CCCCGCTCTCTTGGGGCGTGGCT No data
Right 1173813892 20:45972495-45972517 GTGGGGGGCGTGGCTCCCGGTGG No data
1173813882_1173813892 2 Left 1173813882 20:45972470-45972492 CCGCTCTCTTGGGGCGTGGCTCC No data
Right 1173813892 20:45972495-45972517 GTGGGGGGCGTGGCTCCCGGTGG No data
1173813881_1173813892 3 Left 1173813881 20:45972469-45972491 CCCGCTCTCTTGGGGCGTGGCTC No data
Right 1173813892 20:45972495-45972517 GTGGGGGGCGTGGCTCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173813892 Original CRISPR GTGGGGGGCGTGGCTCCCGG TGG Intergenic