ID: 1173819999

View in Genome Browser
Species Human (GRCh38)
Location 20:46013597-46013619
Sequence TTGGACACAGGGCCAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173819999_1173820013 24 Left 1173819999 20:46013597-46013619 CCGCCCACTGGCCCTGTGTCCAA 0: 1
1: 0
2: 2
3: 52
4: 331
Right 1173820013 20:46013644-46013666 CTCGCTTTCTCAGGAAGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 67
1173819999_1173820009 15 Left 1173819999 20:46013597-46013619 CCGCCCACTGGCCCTGTGTCCAA 0: 1
1: 0
2: 2
3: 52
4: 331
Right 1173820009 20:46013635-46013657 CTTTCCCTCCTCGCTTTCTCAGG 0: 1
1: 0
2: 3
3: 32
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173819999 Original CRISPR TTGGACACAGGGCCAGTGGG CGG (reversed) Intronic