ID: 1173820158

View in Genome Browser
Species Human (GRCh38)
Location 20:46014275-46014297
Sequence GTGAGCGCCGCCGCGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173820150_1173820158 28 Left 1173820150 20:46014224-46014246 CCGGAGTGGCAGGGGGAAGATGC 0: 1
1: 0
2: 0
3: 21
4: 235
Right 1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 29
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173820158 Original CRISPR GTGAGCGCCGCCGCGGCCGC CGG Intronic
900176558 1:1293800-1293822 GTGAGCGCGGCCGGGCCCTCGGG - Intronic
900244269 1:1630306-1630328 GCGAGCGCCGCCCCCGCCCCCGG + Exonic
900989449 1:6091565-6091587 CTGAGCTCCGCGGCGGCCGGGGG + Intronic
901037629 1:6345840-6345862 GTGAGCCCCAGCGTGGCCGCGGG + Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
907010628 1:50959889-50959911 GCCACCGCCGCCGCCGCCGCCGG + Exonic
914869121 1:151458817-151458839 GCGCGCGCCGCGGCGGGCGCCGG + Intronic
917904607 1:179576089-179576111 TTCAGCGCCGCCCCGGCCGTGGG - Intergenic
919075509 1:192808656-192808678 GGGAGCGCCGGCGCCCCCGCCGG + Intergenic
1063429542 10:5977182-5977204 GAGAGCGCCGCCGCTGCGCCCGG - Intronic
1064354389 10:14604284-14604306 CTGGGCGCCGCCGCGGGCGCCGG - Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1070768407 10:79069240-79069262 GCGAGCGCCGCTGCCGCCGCTGG - Exonic
1072189134 10:93066350-93066372 CTGGGCGCCGCCGCGGCAGGCGG - Intronic
1072784101 10:98268494-98268516 GGGAGGGCCGCGGCGGCCTCGGG + Intergenic
1073025206 10:100482605-100482627 GGGAACGCCGCAGCTGCCGCCGG + Exonic
1073062229 10:100739714-100739736 GTCATCGCCGCCGCGACCGTGGG - Intronic
1073063521 10:100745672-100745694 GCGCACGCCGCCGCGGCCGAAGG - Intronic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1073177756 10:101566727-101566749 GGGAGCCCAGCCGCTGCCGCCGG + Intergenic
1073250980 10:102120197-102120219 GCGAGCGCAGCGGGGGCCGCGGG - Exonic
1073812433 10:107164952-107164974 CTCTGCGCCCCCGCGGCCGCGGG + Intergenic
1074586016 10:114768267-114768289 GTCAGCGCTGCCGCGCCCGGCGG - Intergenic
1077540922 11:3146164-3146186 GAGAGCTCCGACGGGGCCGCGGG - Intronic
1078345133 11:10541145-10541167 GGCAGCGCAGCCGCTGCCGCAGG - Exonic
1078659825 11:13277858-13277880 CTCACCGCCGCCGCCGCCGCGGG + Exonic
1078771753 11:14358582-14358604 GAGCGCGACGCTGCGGCCGCAGG + Intronic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1079126241 11:17720336-17720358 GTGCTCGCCGCCGCGGCCCGGGG - Exonic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083986861 11:66221248-66221270 GTGAGCGCAACCGCGACTGCGGG + Intronic
1084046042 11:66568274-66568296 TTGTGCGCGGCCGCGTCCGCCGG - Exonic
1084546572 11:69817911-69817933 GTGAGCGCAGCCCGGGCCGCGGG + Intronic
1085011112 11:73142266-73142288 GTGGGGGCCGCTGCGTCCGCCGG - Intergenic
1085333045 11:75668677-75668699 CTGTGCGCCGCCGCAGCCGCAGG - Exonic
1085423206 11:76381063-76381085 TTTACCGCCGCCGCCGCCGCTGG + Intergenic
1088481065 11:110296702-110296724 CTGAGCGCCAACGCCGCCGCTGG + Exonic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1091303633 11:134523562-134523584 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303653 11:134523624-134523646 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303684 11:134523717-134523739 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303705 11:134523779-134523801 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303765 11:134523965-134523987 GTGAGAGCCGGCCCGGCCGCGGG + Intergenic
1091303786 11:134524027-134524049 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303796 11:134524058-134524080 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303817 11:134524120-134524142 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1091303837 11:134524182-134524204 GTGAGAGCCCGCCCGGCCGCGGG + Intergenic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096284145 12:50283548-50283570 GTGCGCGCCCCCGCGGCGGTGGG - Intergenic
1097267565 12:57755076-57755098 GTCTCCGCCGCCGCCGCCGCCGG + Exonic
1098161028 12:67648624-67648646 GTGTGCGTGGCCGCGGCCGGGGG + Intronic
1098943067 12:76559559-76559581 GGCAGTGCCTCCGCGGCCGCTGG - Exonic
1101371883 12:104138026-104138048 GCCAACGCCGCCGCGGCCGGGGG - Intronic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1102035603 12:109769016-109769038 GTGACCACCACCGCCGCCGCTGG - Exonic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1103325334 12:120116576-120116598 GTGAGGGCCGCAGCGGCCGGAGG - Intronic
1103954253 12:124567590-124567612 GCCACCGCCGCCGCGGCCGCCGG - Intergenic
1105034503 12:132908911-132908933 GTGAGCCCGGCGGCTGCCGCCGG + Intronic
1105239680 13:18598393-18598415 GTCAGCGCCGCAGCTGCAGCAGG - Intergenic
1106180036 13:27362461-27362483 GTGAGCGCCGCTCTGGGCGCGGG - Intergenic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1107534076 13:41311277-41311299 GGAACCGCCGCCGCCGCCGCTGG + Exonic
1108292556 13:48976057-48976079 CTCAGGGCCGCCGCGGCCGCCGG - Intronic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1112290928 13:98143460-98143482 GAGGGAGCCGCCGCAGCCGCCGG + Intronic
1113834593 13:113320388-113320410 GTGGGCGCCGCAGCTCCCGCTGG - Exonic
1115398574 14:32934879-32934901 GTGACGGCCGCGGCGGCCGGCGG + Intergenic
1116820424 14:49621417-49621439 GTGGTCCCCACCGCGGCCGCCGG - Exonic
1117072675 14:52069932-52069954 GTTACCGCCTCCGTGGCCGCGGG - Intergenic
1117302233 14:54441156-54441178 GTCCGGGCCGCCACGGCCGCCGG - Intronic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122220978 14:100239072-100239094 GCGGGCGCCGCGGCGGCGGCGGG - Exonic
1125485580 15:40108750-40108772 GTGAGCGCCCGGGTGGCCGCCGG - Intronic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1127606315 15:60591841-60591863 CCGAGCGCCTCAGCGGCCGCCGG - Intronic
1128119233 15:65133548-65133570 GCCAGCGCCGCCTCCGCCGCGGG + Exonic
1131367603 15:91853531-91853553 GTGAGAGCAGGCGCGGCCGGCGG + Intergenic
1132365127 15:101251566-101251588 GGCAGCGCCGCCGCCGCCGCGGG + Exonic
1132464792 16:72486-72508 GTGAGCGCGGCCGGGAGCGCAGG - Intronic
1132466207 16:78391-78413 GCGAGCGCGGCCGCGGGAGCGGG + Intronic
1132569211 16:636865-636887 GCGTGCGCCGCCGCTGGCGCCGG + Intronic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132779334 16:1614282-1614304 GGGAGCCCCGGCGCGGGCGCGGG - Intronic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1134482309 16:14630283-14630305 GTCAGCGCCTGCGCGGCGGCGGG + Intronic
1136365469 16:29807212-29807234 GGGGGCGCGGCCTCGGCCGCGGG - Exonic
1137655226 16:50153425-50153447 GGGAGCGACGCCGCCGGCGCCGG + Intronic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1139496930 16:67326761-67326783 GCGCGCGCCGCCGCGACCCCGGG - Exonic
1139534372 16:67562506-67562528 GTCGGCGCTGCCGGGGCCGCGGG - Exonic
1141173631 16:81705605-81705627 GTGAGTGCCTCCGGGGCAGCTGG + Intronic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141720123 16:85751232-85751254 GGGACCGCCGCCGAGGGCGCCGG - Intergenic
1142350096 16:89575822-89575844 GTCGGCGCCGCCGCGGCGCCCGG - Exonic
1142509640 17:385755-385777 GTGCGCGCCGGGGCGGGCGCTGG + Intronic
1142858884 17:2749357-2749379 GTGGGCGCCGGAGCGGCCCCAGG - Intergenic
1144971295 17:19111316-19111338 GGGTGCGCCGCTGCGGCCACCGG - Intergenic
1144991600 17:19237487-19237509 GGGTGCGCCGCTGCGGCCACCGG - Exonic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1147159459 17:38561919-38561941 CTGAGCCTGGCCGCGGCCGCCGG - Exonic
1147352726 17:39864249-39864271 GTCTGCGCCGACGCGGCTGCCGG - Intergenic
1147486367 17:40818909-40818931 GTAGCCGCCGCCGCCGCCGCCGG + Exonic
1147943499 17:44066591-44066613 GGGAGTGCAGCCGCGGCCGGCGG + Exonic
1148156929 17:45429966-45429988 GTGAGCGCGGCGGCGACCGCGGG - Intronic
1148786908 17:50150035-50150057 CGGAGCGCCCCAGCGGCCGCAGG - Exonic
1149038350 17:52158825-52158847 GTGAGCGTCCTCGCCGCCGCCGG + Intronic
1149270210 17:54968980-54969002 GAGAGCGTCGCCGGGGCTGCCGG - Intronic
1150790833 17:68199250-68199272 GTGAGCGCGGCGGCGGCAGCGGG + Intergenic
1151780215 17:76240465-76240487 GGGGGCGCCGCCGCCGCCTCAGG + Intergenic
1151919145 17:77140867-77140889 GCGTGCGCGGCCGCGGCCGAGGG - Intronic
1152212447 17:79009637-79009659 GTGACTGCGCCCGCGGCCGCCGG - Intronic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152721898 17:81927505-81927527 GTGAGTGCGGCTGCGGCGGCGGG - Intronic
1152824847 17:82458438-82458460 TTGGCCGCCGCCGCCGCCGCAGG + Intronic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1155221499 18:23689798-23689820 CTGAGCCCGGCCGCGGCCCCGGG - Exonic
1156350705 18:36298540-36298562 GGGGGCGCCGCCGGGGACGCCGG + Intronic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1157609980 18:48950165-48950187 GCGGGCGCCGGCGCGGCCGGGGG - Exonic
1158579938 18:58671936-58671958 CTGAGCGCGGCGGGGGCCGCCGG + Intronic
1160005168 18:75063869-75063891 GTGAGCACCTCCACGGCGGCCGG - Exonic
1160722541 19:603913-603935 GTGAGAGGCGCAGCAGCCGCAGG - Exonic
1160784077 19:891718-891740 GTCAGCCCCGCCTCGGCCACAGG - Intronic
1160853536 19:1206016-1206038 GCCTGCGCCGCCTCGGCCGCCGG + Intronic
1160864331 19:1250366-1250388 ATGGGCGCCGCCTCGGCCGCCGG - Exonic
1160873225 19:1286309-1286331 GTGAGCGCGGCCGCGCGCGGGGG + Intronic
1160891990 19:1383943-1383965 GTGAGCGCGGCACCGGCGGCGGG + Intronic
1161089153 19:2351687-2351709 CTGAGCCCCGTCGCGGCCGCAGG - Intronic
1161101869 19:2425494-2425516 GTGAGCCCCGCCCCGGCCCAGGG + Intronic
1161203629 19:3029164-3029186 GCGAGGGCGGCCGCGGCAGCCGG + Exonic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161314685 19:3612413-3612435 GTGAACGCCGTCCCGCCCGCAGG - Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1161955065 19:7489095-7489117 TTGCGCGCAGGCGCGGCCGCAGG + Intronic
1163051812 19:14690056-14690078 GTGCGCGCGGCGGCGGCCGACGG + Intronic
1163453041 19:17390517-17390539 GTGCGCGCCGCGCCGGCCGCCGG + Intergenic
1163760665 19:19134761-19134783 GTGAGCCCCGCCCCGGCGGTGGG - Intronic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1165274283 19:34734397-34734419 CTGAGCCCCGCCGCCGCCCCCGG - Intronic
1165349794 19:35269318-35269340 GGGGGCGCCGCCGAGGCCGGGGG - Intronic
1165916523 19:39264394-39264416 GTGTGGGCCGCGGTGGCCGCGGG + Intergenic
1166304103 19:41928013-41928035 GTGAGCGCCGCGGCCGGCGCAGG - Intronic
925169940 2:1744233-1744255 GTGAGTGCCGCGGGGGACGCCGG - Intronic
926635101 2:15170202-15170224 ATGAGAGCAGCAGCGGCCGCAGG - Intronic
927809371 2:26173116-26173138 GCGAGCGCCGCGGCGGCCCCGGG + Exonic
928025494 2:27735764-27735786 GAGAGCCCCGCCGGGGCTGCCGG - Intergenic
930096462 2:47570347-47570369 CCGAGCGCCGCCCCGGCCCCGGG - Exonic
932599297 2:73112874-73112896 CTGAGCGCCGCCGCAGCTGCGGG + Exonic
934783195 2:96986121-96986143 GTCAGCCCCGGTGCGGCCGCCGG - Intronic
937043125 2:118836117-118836139 GTCAGCGCAGCCCAGGCCGCAGG - Intergenic
940918891 2:159286560-159286582 GTGAGAGCGGCCGCGCCCACGGG - Exonic
942043001 2:172083263-172083285 GTGATCGCCGCGGCGGGCGCGGG - Intergenic
942446209 2:176080477-176080499 TTGAGCCCCGCGGCGGCCGCGGG + Exonic
942446772 2:176083372-176083394 CTGAGCGGCGCCGAGGCCCCCGG + Exonic
945102503 2:206274947-206274969 GTGAGTGCCGCGGCGGGGGCGGG + Intronic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948438127 2:237967395-237967417 GTGACCGCGGCGGCGGCGGCGGG + Intronic
948910139 2:240998719-240998741 GGGAGCGCGGGCGCGCCCGCTGG - Intergenic
1169093165 20:2873619-2873641 GAGGCCGCCGCCGCCGCCGCGGG + Intronic
1172284617 20:33732053-33732075 GTGAGCGGCGGCGGGGCCGGCGG + Intronic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1175374454 20:58514838-58514860 GTGAGCGCCGAGGGGGGCGCAGG - Exonic
1176014935 20:62926220-62926242 GTCAGAGCCGCCGCGGCCTGGGG - Intronic
1176061602 20:63175140-63175162 GTGCGCACCGAGGCGGCCGCCGG + Intergenic
1180157959 21:45987096-45987118 GGGAGGCCCGCGGCGGCCGCAGG + Intronic
1180649957 22:17369506-17369528 GCGGCCGCCGCCGCAGCCGCGGG + Exonic
1181155441 22:20917363-20917385 GGGAGGGCCCCGGCGGCCGCCGG + Intergenic
1181471842 22:23145486-23145508 GTGATCGCCGCCGCTGGCTCAGG + Exonic
1181514363 22:23402665-23402687 CTGGGCGCCGGCGCGGGCGCGGG + Intergenic
1181567894 22:23750958-23750980 GTGAGTGGCCCCGCGTCCGCCGG - Exonic
1181915076 22:26273456-26273478 CTGTGCGCCGCCTCGGCCTCAGG + Intronic
1182904055 22:33921081-33921103 GCGGGCGCCGACGCGGGCGCCGG - Intronic
1183393770 22:37560463-37560485 GTCTGCGCCGCCCTGGCCGCGGG - Exonic
1185333450 22:50261632-50261654 GGGAGCGCCCCAGCGGCCGGCGG - Exonic
1185336173 22:50271777-50271799 GGAACCGCGGCCGCGGCCGCCGG + Intergenic
950193373 3:10992908-10992930 GGCAGCGCAGCCCCGGCCGCAGG + Exonic
951080455 3:18445225-18445247 GTGGGAGCCTCGGCGGCCGCTGG + Intronic
952970994 3:38649869-38649891 GTGTGCGCCCCGGCGGGCGCTGG - Intergenic
954618627 3:51983380-51983402 ATCCGCGCCGACGCGGCCGCTGG + Exonic
954733538 3:52685764-52685786 GTGACCGCGGCCGGGGCTGCAGG - Exonic
959591896 3:108090924-108090946 GGGGTCGCCGCCGCCGCCGCAGG + Exonic
960747805 3:120908773-120908795 GAGAGCGCGGCGGCGGCTGCGGG + Intronic
962301958 3:134250877-134250899 GTGCGCGCCGCCGCCTCCCCGGG + Intergenic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
966182237 3:177197669-177197691 GGGAGGGGCGCCGCGGACGCCGG + Intergenic
966592241 3:181695879-181695901 GTCGGCCCCGCCGCGGCCCCAGG + Intergenic
968083060 3:195860220-195860242 GTGCCCGCCGCCTCGGCTGCAGG + Intergenic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968965283 4:3766341-3766363 GCGAGCGGCGACGCGGCTGCGGG - Intronic
970195218 4:13544928-13544950 GTAGCCGCGGCCGCGGCCGCTGG + Exonic
972396387 4:38663294-38663316 GGGGGCGCCGCCTGGGCCGCCGG + Intergenic
973551271 4:52038200-52038222 GTGAGTACCGCCGCGGCCGCGGG - Intronic
974047153 4:56907964-56907986 GCGAGCGCCGCCGAGGCCCGGGG + Exonic
987088009 5:14487599-14487621 GGGGGCGCCGCCGCAGCTGCTGG - Exonic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
987340538 5:16935858-16935880 GTCAGCGCCGCCGCGGGTCCGGG + Exonic
987379930 5:17275607-17275629 GAGAGCGCGGCCCCTGCCGCCGG + Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
989592217 5:43121843-43121865 GAGACCGGAGCCGCGGCCGCGGG - Exonic
990545317 5:56815920-56815942 GTGGGCGCCGCCGCGGCTCGCGG - Exonic
992676353 5:79110080-79110102 GTGAGCCCCGCGGTGGCTGCAGG - Intronic
997302043 5:132813526-132813548 GTGAGCGCGGCCGCGCCTCCCGG + Intergenic
998903346 5:146878403-146878425 GTGAGCGCCTCCGGGGCGGGCGG - Intronic
999232324 5:150069104-150069126 GTGAGGCCCAGCGCGGCCGCAGG + Intronic
1002006359 5:176238181-176238203 GTGCGAGACGCCGAGGCCGCGGG - Intergenic
1002046262 5:176543260-176543282 TGGAGCCCCGCCGCGGCCCCAGG - Intronic
1002046273 5:176543290-176543312 GGGAGCGACGCGCCGGCCGCCGG - Intronic
1002184262 5:177446961-177446983 GTGAGTACCGCGGCGGCTGCGGG + Intronic
1002220018 5:177672455-177672477 GTGCGAGACGCCGAGGCCGCGGG + Intergenic
1002927083 6:1610946-1610968 TGAAGCGCCGCCGCCGCCGCAGG - Exonic
1003108207 6:3231373-3231395 GGCAGCTCCGCCGGGGCCGCTGG - Intronic
1004216670 6:13710863-13710885 GAGAGCGGCGCAGCGGCGGCCGG + Intronic
1004690234 6:17987306-17987328 GAGAGCGCGGCCGGGGCCGGGGG - Intronic
1007644437 6:43369468-43369490 CTGCGCGCCGCCTCAGCCGCGGG + Intronic
1007784203 6:44270780-44270802 GCCACCGCCGCCGCCGCCGCCGG - Exonic
1008945268 6:57090118-57090140 GTGAGCGCCGACGCCACCGGCGG - Exonic
1014632524 6:123803870-123803892 GGCAGCGCCGCCGCGCCCTCGGG - Intergenic
1015366218 6:132401024-132401046 GTGAGCGTGGCCGGGGGCGCGGG + Intronic
1015935458 6:138403504-138403526 GTGACCGCCGCAGAGGCAGCAGG - Intergenic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1016923474 6:149317889-149317911 GCCAGCGCCGCCGCCGCCTCCGG - Intronic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1018635278 6:165854819-165854841 GTGGGCGCCGCCAAGGCCACGGG - Intronic
1018674328 6:166205979-166206001 GAGCGCGCCACCGCGGCTGCTGG + Intergenic
1018866257 6:167748815-167748837 GTCAGTGCCGCCGCAGCCCCAGG + Intergenic
1018947262 6:168356599-168356621 GTGAGCACCGCAGCGGACCCAGG + Intergenic
1019112009 6:169724211-169724233 GTGAGAAGCGCCGCCGCCGCTGG - Intronic
1019421676 7:953895-953917 GTGAGCGGCGCCCCTGCCCCCGG - Intronic
1019643022 7:2114926-2114948 GTGAGCACCGCTGCAGCAGCAGG + Intronic
1024578305 7:50782393-50782415 GTGGGCTCCGCCGCGGGCGCTGG - Intronic
1027190780 7:75994467-75994489 GTTAGCGCCGCTGCGGACGCCGG - Intronic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029168933 7:98617439-98617461 CTGAGCGCGGCAGCGGCGGCGGG + Exonic
1029711244 7:102301160-102301182 GTGGCCGACGACGCGGCCGCGGG + Exonic
1034522624 7:151632319-151632341 GAGGCCGCCGCCGCCGCCGCAGG + Intronic
1042216298 8:66432313-66432335 GCGAGCGCCGCTGGGGCAGCTGG + Intronic
1049189660 8:141279994-141280016 GTGGCCGCCGCTGCTGCCGCTGG - Intronic
1049746827 8:144266539-144266561 GCGAGGCCCGCGGCGGCCGCAGG + Exonic
1050230897 9:3525507-3525529 GTGGGCGCCGCGCCGCCCGCCGG - Intronic
1054775656 9:69121691-69121713 GCGGCCGCCGCCGCGGCCGGCGG - Intronic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1056143686 9:83708275-83708297 GCAGGCGCAGCCGCGGCCGCAGG - Intergenic
1057337352 9:94166347-94166369 GAGAGGGCCGTCGCGGCCGTGGG - Intergenic
1057922035 9:99105303-99105325 GTGAGCGGCGGCGCGGCGGGCGG + Intronic
1057997138 9:99828685-99828707 CTGAGCGCGGCAGCGGCCGTCGG - Exonic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1187915549 X:24149802-24149824 CCGGGTGCCGCCGCGGCCGCGGG + Intronic
1190300337 X:49053659-49053681 GGGAGCGCCGGCCCGGCCGCGGG - Intronic
1190712861 X:53082244-53082266 GCGATCGCCGCCGCGGCGGCCGG + Intergenic
1192425140 X:71068408-71068430 GTGCGCGCCGCCGCCGCCTGTGG - Intronic
1197709371 X:129654774-129654796 CTGAGCCCCGCCGCTCCCGCTGG + Exonic
1200068905 X:153518191-153518213 GTGGGCGCAGCCGGGGGCGCGGG + Intronic
1200330503 X:155291893-155291915 AGGAGCGCTGCCGCCGCCGCAGG + Intronic