ID: 1173821710

View in Genome Browser
Species Human (GRCh38)
Location 20:46023846-46023868
Sequence TGAGTTCCAGACCCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173821705_1173821710 26 Left 1173821705 20:46023797-46023819 CCATTGGAACATCTCAAGGACAG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG No data
1173821704_1173821710 29 Left 1173821704 20:46023794-46023816 CCTCCATTGGAACATCTCAAGGA 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG No data
1173821709_1173821710 -6 Left 1173821709 20:46023829-46023851 CCTTTATCTTTGTGTTCTGAGTT 0: 1
1: 0
2: 2
3: 36
4: 395
Right 1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG No data
1173821708_1173821710 0 Left 1173821708 20:46023823-46023845 CCATCTCCTTTATCTTTGTGTTC 0: 1
1: 2
2: 3
3: 60
4: 741
Right 1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173821710 Original CRISPR TGAGTTCCAGACCCAGAGCC TGG Intronic
No off target data available for this crispr