ID: 1173822727

View in Genome Browser
Species Human (GRCh38)
Location 20:46029530-46029552
Sequence AGCCTGGAGCTCAGCTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173822723_1173822727 0 Left 1173822723 20:46029507-46029529 CCCGGGCGGTGGGCGCCAGTTGC No data
Right 1173822727 20:46029530-46029552 AGCCTGGAGCTCAGCTCCATTGG No data
1173822715_1173822727 28 Left 1173822715 20:46029479-46029501 CCTCCTTCAGAGAGGAGGCTGGG No data
Right 1173822727 20:46029530-46029552 AGCCTGGAGCTCAGCTCCATTGG No data
1173822717_1173822727 25 Left 1173822717 20:46029482-46029504 CCTTCAGAGAGGAGGCTGGGACT No data
Right 1173822727 20:46029530-46029552 AGCCTGGAGCTCAGCTCCATTGG No data
1173822724_1173822727 -1 Left 1173822724 20:46029508-46029530 CCGGGCGGTGGGCGCCAGTTGCA No data
Right 1173822727 20:46029530-46029552 AGCCTGGAGCTCAGCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173822727 Original CRISPR AGCCTGGAGCTCAGCTCCAT TGG Intronic