ID: 1173823126

View in Genome Browser
Species Human (GRCh38)
Location 20:46031187-46031209
Sequence CACACTGATGCCTCTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173823126_1173823128 0 Left 1173823126 20:46031187-46031209 CCTAGAAAAGAGGCATCAGTGTG 0: 1
1: 0
2: 3
3: 28
4: 287
Right 1173823128 20:46031210-46031232 TGTGAGGCAAGAGTTGAACTAGG 0: 1
1: 0
2: 6
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173823126 Original CRISPR CACACTGATGCCTCTTTTCT AGG (reversed) Intronic
900081702 1:863331-863353 CTCTCTCATGCCTCTTTCCTTGG + Intergenic
900833077 1:4978971-4978993 CACACTGCTGTCTCTTGTTTGGG - Intergenic
901674444 1:10874767-10874789 CACTCTGTGGCCTCTTTGCTGGG + Intergenic
902017220 1:13318354-13318376 GAGAGTGATGCCTCTTCTCTGGG + Intronic
903297105 1:22350829-22350851 CCCACTGTTGCCCCCTTTCTTGG - Intergenic
903603635 1:24559422-24559444 CTCACTGCTGGCTCTTTTCTTGG - Intronic
905318647 1:37099777-37099799 CACAATGCTGCCTCTTTTGCGGG + Intergenic
905739098 1:40353921-40353943 GACACTGATGCTGCTTGTCTGGG + Intronic
908449177 1:64233987-64234009 CACACTGCTGCCTCTTCCCTTGG + Intronic
910649214 1:89546734-89546756 TACACTGAGGGCTCCTTTCTGGG - Intronic
912745946 1:112245626-112245648 AACTGTGATTCCTCTTTTCTTGG - Intergenic
913111786 1:115663793-115663815 CTCACCGTCGCCTCTTTTCTTGG + Exonic
915996164 1:160566205-160566227 AACACTTTTGTCTCTTTTCTTGG + Intronic
917918537 1:179729088-179729110 CATACTGAGGCTTCTCTTCTTGG + Intergenic
918109829 1:181445808-181445830 CATACTGATGCCTCCCTTTTTGG - Intronic
918687889 1:187442328-187442350 GCCAATGAAGCCTCTTTTCTGGG + Intergenic
920783252 1:209014966-209014988 GAGAGTGATGCCTCTTTTCCTGG + Intergenic
920966807 1:210707778-210707800 CACATTGATGGCCCTTTTATAGG - Intronic
924416439 1:243861130-243861152 GACACTTAAGCCCCTTTTCTAGG + Intergenic
1063230947 10:4065174-4065196 CACTCTGAGGTCTCTTTTATGGG - Intergenic
1063307802 10:4921967-4921989 CACAGGGATGCCTCATTCCTAGG + Intergenic
1063564252 10:7158504-7158526 CACACTAAAGCCTTATTTCTAGG - Intergenic
1064098533 10:12442881-12442903 CACACTGCTGTCTCTTGTCATGG - Intronic
1065150333 10:22816403-22816425 CACACTGATGACTCTCCTCCAGG - Intergenic
1065920426 10:30387935-30387957 CATTCTGAGGCCTCTTCTCTTGG + Intergenic
1065970200 10:30799904-30799926 TGCACTGTTGCCTTTTTTCTGGG - Intergenic
1069402594 10:68064526-68064548 CACTCTGTTGCCTATTGTCTAGG - Intronic
1070508673 10:77140143-77140165 CACCTTGATTCCTGTTTTCTTGG - Intronic
1070695852 10:78562460-78562482 AGGACTGATGCCTCATTTCTAGG + Intergenic
1072036850 10:91570601-91570623 CTCACTCAGGCCTCTTTTATAGG - Intergenic
1074071048 10:110069693-110069715 CATTCTTATGCCTCTTTTCATGG + Intronic
1075278759 10:121120369-121120391 TACACTGATAACTCATTTCTGGG + Intergenic
1075456803 10:122590115-122590137 CAGTCTGATGCCTCCTTACTGGG - Intronic
1075659723 10:124184937-124184959 CATACTGATGCCTCTCCTCCTGG + Intergenic
1075900921 10:126042241-126042263 CTAAATGATGCCTCTTTTCGAGG - Intronic
1076189896 10:128475605-128475627 CACCCTGCTGCCCTTTTTCTTGG - Intergenic
1078132774 11:8626487-8626509 TTCACTGATGCCTCCTTCCTAGG - Intronic
1078672949 11:13381222-13381244 CCCCCTGATGCCTCTTCTCCAGG + Exonic
1078944366 11:16047028-16047050 CACAATGTTGCCTCTTCTGTGGG + Intronic
1079989045 11:27227917-27227939 TACACTGGTGCCTCTTTGCTGGG + Intergenic
1080070449 11:28077808-28077830 CACACTGCAGCAGCTTTTCTAGG - Intronic
1080988175 11:37496405-37496427 CACACTGATACAGCTTTTCCTGG + Intergenic
1082647317 11:55743908-55743930 CAAACTGATGCCATTTTTCTGGG + Intergenic
1084359503 11:68660460-68660482 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
1084778004 11:71389884-71389906 GACACTGATCCCTCCTTTCTTGG + Intergenic
1084850699 11:71937534-71937556 CACACTGGTGTCCATTTTCTGGG - Intronic
1085156623 11:74301463-74301485 CATACTGTTTTCTCTTTTCTGGG - Intronic
1086862972 11:91947156-91947178 CAGACTGAGGTCTCATTTCTAGG + Intergenic
1089745464 11:120613905-120613927 TTCACAGATTCCTCTTTTCTAGG - Intronic
1092695082 12:11162536-11162558 CACACTTATGCTCCTTTCCTGGG - Intronic
1093525424 12:20099558-20099580 CACTCTGCTGACTGTTTTCTGGG - Intergenic
1093725068 12:22496833-22496855 CTCACTGATGTCTCTTTTAGGGG + Intronic
1095050404 12:37548915-37548937 CACTGAGAGGCCTCTTTTCTAGG + Intergenic
1095710926 12:45287147-45287169 CAGAATGATGGCTCTTCTCTAGG + Intronic
1096431955 12:51552212-51552234 CACACTGATTCATCAATTCTAGG - Intergenic
1098096739 12:66964841-66964863 TCCTCTGAGGCCTCTTTTCTTGG + Intergenic
1099901794 12:88719822-88719844 AGCACTGATACCTCTTTGCTAGG - Intergenic
1102584311 12:113912436-113912458 CTCTCTGCTGCCTGTTTTCTTGG - Intronic
1104926859 12:132318372-132318394 CACATGGATGCCTCTCTTCAGGG + Intronic
1107529184 13:41265724-41265746 CAGTCTGATACCTCTTCTCTTGG - Intergenic
1108950913 13:56091041-56091063 CAAACTCATGGCACTTTTCTGGG - Intergenic
1109344954 13:61103653-61103675 CACATTGGTGGCCCTTTTCTGGG + Intergenic
1110515770 13:76411008-76411030 CACAATGATGCCTCCCTTGTTGG + Intergenic
1111670110 13:91319932-91319954 CACACACATGCCCCTTTTCCTGG + Intergenic
1112484007 13:99803304-99803326 CACAATGTTGCCTTTGTTCTAGG - Intronic
1112744584 13:102512284-102512306 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
1115728118 14:36239267-36239289 CATTCTCATGCCTTTTTTCTGGG + Intergenic
1116365535 14:44058181-44058203 TTCACTGAGGCCTCTTCTCTTGG + Intergenic
1117618037 14:57554301-57554323 CAGACTGATGCCTCTTTTTTTGG + Intergenic
1118816826 14:69319809-69319831 GACAGTGATGCATCTTCTCTGGG - Intronic
1120504605 14:85339455-85339477 CACACTGTTGGGTCTTTTCCTGG + Intergenic
1120991352 14:90380226-90380248 CTCTCTGATGCCTCTCTTATAGG - Intergenic
1122451887 14:101815590-101815612 CTAACTGATGCCTCTACTCTAGG - Intronic
1125155916 15:36585327-36585349 TTCACTGATGTCCCTTTTCTAGG + Intronic
1126451995 15:48818479-48818501 CTCTCTGAGGCCTCTTTTATAGG + Intergenic
1127795843 15:62437677-62437699 GATACTGATGCCTCTGTTTTAGG + Intronic
1127889876 15:63240570-63240592 AAAACTGTTGCCTATTTTCTAGG + Intronic
1128477687 15:68011369-68011391 CACAGTGATGCCACTTTTAAAGG + Intergenic
1129405230 15:75312618-75312640 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
1129478897 15:75807548-75807570 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
1129837009 15:78715059-78715081 CATTCTGAGGCCTCTTCTCTTGG - Intronic
1130549360 15:84879958-84879980 CACACTGCTGCTTCTTCCCTTGG + Intergenic
1131187879 15:90291347-90291369 CACAATGATTTCTCTTTTTTTGG - Intronic
1132080722 15:98862995-98863017 CCCACTGATGTCCCTTTTTTTGG + Intronic
1134260063 16:12643997-12644019 CACACTCATCCCTCTTCACTTGG - Intergenic
1134591542 16:15458169-15458191 TGAACTGATGCCTCTTCTCTTGG + Intronic
1135042413 16:19127992-19128014 GACTCTGATGCCTCTTTTTTTGG - Intronic
1135348615 16:21710278-21710300 CATTCTGAGGCCTCTTCTCTTGG + Intronic
1135839857 16:25866005-25866027 CTCACTGTTGACTATTTTCTTGG - Intronic
1136494898 16:30636736-30636758 CACAGTGAGGCCCCGTTTCTGGG - Intergenic
1137923596 16:52517455-52517477 CATACAGATGGCTCTCTTCTTGG + Intronic
1141121517 16:81362096-81362118 CACACGGATGCCTCAGATCTGGG + Intronic
1142794053 17:2293175-2293197 CACACTGCTGACTGTTTTTTTGG - Intronic
1143662225 17:8332679-8332701 CACACTCCTGCCTGTTTTATAGG - Intergenic
1144255716 17:13465114-13465136 TACACTGGTGCCTCTTTTCTGGG - Intergenic
1146068282 17:29655474-29655496 CCCACTGATACCTCTTTGATGGG + Intronic
1146987633 17:37235992-37236014 AACACTAATTCCTCTTTACTTGG - Intronic
1150450156 17:65259804-65259826 CAAACTGATGCTTCTTGTCAAGG + Intergenic
1152459161 17:80432300-80432322 ACCACTGATGCCTCATTCCTGGG - Intronic
1153929770 18:9867844-9867866 CACACTGGGGCCTGTTTTGTGGG - Intergenic
1155361224 18:25004802-25004824 CTCATTAATGCATCTTTTCTTGG + Intergenic
1156285915 18:35695748-35695770 CTCACTGATGCCTCATTAATGGG + Intronic
1156576108 18:38317375-38317397 CAATCTGTTTCCTCTTTTCTGGG - Intergenic
1157105750 18:44772590-44772612 CAGAGTGATGCGTCTGTTCTTGG + Intronic
1158012241 18:52742091-52742113 CATTCTCAGGCCTCTTTTCTTGG - Intronic
1159007715 18:63027307-63027329 ATCACTGCTGCCTCTTTTTTTGG + Intergenic
1159291416 18:66427006-66427028 GACAATGATGCCTCATTGCTAGG - Intergenic
1159866878 18:73716238-73716260 CATCCTGAGACCTCTTTTCTTGG + Intergenic
1165088305 19:33366952-33366974 TACTCTGAAGCCTCTTTTCTTGG - Intergenic
1165160241 19:33811670-33811692 CACATTGTTGCCTTTTTTGTAGG - Intronic
1165894193 19:39131675-39131697 CTCACTGAAGCCTCTCTCCTGGG + Intronic
1167980161 19:53269342-53269364 CACAACCATTCCTCTTTTCTTGG + Intergenic
1168497764 19:56868472-56868494 CAAACTGATGCCTTTTTTATTGG + Intergenic
925645222 2:6029156-6029178 CTCTCTGGAGCCTCTTTTCTAGG - Intergenic
926961511 2:18363258-18363280 AATGCTGATGCCACTTTTCTGGG + Intergenic
927524580 2:23725860-23725882 CTCACTGATACTTATTTTCTGGG - Intergenic
928035544 2:27819208-27819230 CATTCTGAGGCCTCTTCTCTTGG + Intronic
928112395 2:28521428-28521450 CTCACCAATGCCTGTTTTCTGGG + Intronic
928380389 2:30812844-30812866 AACAATGATGCCTCTCTTGTAGG - Intronic
929379167 2:41329657-41329679 CTCTCTGAGCCCTCTTTTCTAGG - Intergenic
930365723 2:50436962-50436984 CAAACTGTAGCCTCTTTACTAGG + Intronic
930833563 2:55771248-55771270 CAAACGATTGCCTCTTTTCTGGG - Intergenic
930975108 2:57448695-57448717 TAAACTGATAGCTCTTTTCTGGG + Intergenic
931310508 2:61075230-61075252 CACACTGATGTTTCTTTTTGAGG + Intronic
931437884 2:62264735-62264757 CATTCTGAAGCCTCTTCTCTTGG - Intergenic
931771480 2:65501675-65501697 CACACTGCTTCCTCTTCTCCGGG + Intergenic
933470176 2:82712397-82712419 CTCACTGCTGCCTATTTCCTGGG - Intergenic
936632156 2:114215288-114215310 CAAACTGAAGCATCTCTTCTAGG + Intergenic
936694716 2:114932095-114932117 CACACAGATGCTGCTTTTCTGGG - Intronic
936730466 2:115376018-115376040 CCCACTAATGCCTCATTTCTGGG - Intronic
937739154 2:125328922-125328944 CAAATTGAAGCCTATTTTCTAGG - Intergenic
938558176 2:132445568-132445590 GACATTTATGCCTGTTTTCTAGG + Intronic
940948215 2:159643285-159643307 CATTCTGAAGCCTCTTCTCTTGG + Intergenic
942359250 2:175154876-175154898 CATACTGATGCCTACTTTTTGGG - Intronic
942753414 2:179313433-179313455 CCCACTGATGCATCTTTATTGGG - Intergenic
942922788 2:181397163-181397185 CACACAGATGACTCTTTTCATGG + Intergenic
943378864 2:187118044-187118066 TACATTGATGCTTCCTTTCTGGG + Intergenic
943734761 2:191342152-191342174 TATTCTGAGGCCTCTTTTCTTGG + Intronic
945889834 2:215418226-215418248 CACCCAGATGCACCTTTTCTAGG - Intronic
947103246 2:226644040-226644062 CACACTGGTTCCGCTTTCCTGGG - Intergenic
947507372 2:230718842-230718864 CAAAGTGAAGTCTCTTTTCTAGG + Intronic
947919890 2:233860781-233860803 CATTCTGAAGCCTCTTGTCTTGG + Intergenic
948431354 2:237921178-237921200 CCTTCTGATGCCTCTCTTCTTGG + Intergenic
948738948 2:240030421-240030443 CCCACTCATGCCTCTGTGCTTGG + Exonic
948741023 2:240046064-240046086 CCCACTCATGCCTCTGTGCTTGG + Exonic
948871368 2:240800271-240800293 CACAGAGAAGCCTCTGTTCTTGG + Intronic
1169384302 20:5135306-5135328 CACACTTTTCCATCTTTTCTAGG + Intronic
1170702345 20:18714684-18714706 AGCACTGAGGCCTCTTCTCTTGG + Intronic
1171008230 20:21489452-21489474 CTCATTGATGCATCTTCTCTTGG - Intergenic
1172778337 20:37421138-37421160 CACCCAGAGGCCTCTCTTCTTGG - Intergenic
1172839845 20:37896140-37896162 CACTCTGAGGCCTCTTCTCCTGG - Intergenic
1173024114 20:39292197-39292219 CATACTGATCCATCATTTCTGGG + Intergenic
1173823126 20:46031187-46031209 CACACTGATGCCTCTTTTCTAGG - Intronic
1175213341 20:57375531-57375553 CACCCTCATGGCTCTTTTCTGGG + Intronic
1175574966 20:60054013-60054035 CACACTCTTGGCTCTTTGCTGGG - Intergenic
1175583702 20:60120715-60120737 CACAGGGATGCTTCTTATCTAGG + Intergenic
1177373017 21:20231071-20231093 TAAACTTATGCCACTTTTCTAGG - Intergenic
1178021477 21:28413512-28413534 CACACTGCTTCCTCTTGTGTTGG - Intergenic
1178256380 21:31056232-31056254 CATTCTGAGGCCTCTTCTCTTGG + Intergenic
1178351776 21:31876737-31876759 CTCATTAATTCCTCTTTTCTTGG + Intronic
1178501228 21:33127246-33127268 CACAGTGATGCCTCTTGTGGTGG + Intergenic
1182958121 22:34446429-34446451 CAGAATGATGCTTCTTTTCTAGG - Intergenic
1183064548 22:35354072-35354094 AACATTGAGTCCTCTTTTCTGGG + Intergenic
1183078723 22:35442841-35442863 CCCACTGATGCCTCCTGTCAGGG - Intergenic
1183172930 22:36201415-36201437 CACACAGATGTCTGTCTTCTGGG + Intronic
1184596964 22:45519843-45519865 CACCATGATACCTCCTTTCTGGG + Intronic
949662821 3:6300889-6300911 CATAATGATGACTTTTTTCTAGG + Intergenic
950452347 3:13072500-13072522 GACACTGATGCCTCCGTGCTAGG + Intronic
952745825 3:36777792-36777814 CACACTGCTGCTTGTTCTCTTGG - Intergenic
953196726 3:40741211-40741233 TACACAGATCCCTCTTCTCTCGG - Intergenic
955954822 3:64278016-64278038 AATCTTGATGCCTCTTTTCTTGG + Intronic
956056914 3:65309298-65309320 AAGACTGAAGCATCTTTTCTTGG + Intergenic
956844853 3:73173245-73173267 CACACTGTTGTGTTTTTTCTTGG + Intergenic
957153077 3:76511583-76511605 CACACTCATGCCTCTGTTCACGG - Intronic
959343929 3:105168387-105168409 CACATTGATTCCTCTTTTATTGG - Intergenic
959623155 3:108420919-108420941 CACACACATGCCTCTTGTCTAGG - Intronic
960361084 3:116712435-116712457 CACACTGTACCCTCTGTTCTTGG + Intronic
960522881 3:118676266-118676288 CAGGGTGATGCCTATTTTCTAGG - Intergenic
961208527 3:125107442-125107464 CACACTGGGGCCTCTTATTTGGG - Intronic
962059512 3:131910699-131910721 CTCATGGCTGCCTCTTTTCTTGG - Intronic
962118902 3:132541400-132541422 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
962404158 3:135085987-135086009 CACACTGACGCCTTTCTCCTGGG - Intronic
962423095 3:135245413-135245435 GCCACTGATTCCTCCTTTCTGGG - Intronic
964057416 3:152478154-152478176 CTTTCTGATGCCTCTTTGCTAGG + Intergenic
965437324 3:168668158-168668180 CAAACTGATGCCGTTTTTCATGG + Intergenic
967328127 3:188262904-188262926 TACAGTGATGCCTCCTTACTAGG + Intronic
967449115 3:189602661-189602683 CACTCTGAAGCCTCTTCTTTGGG + Intergenic
967509180 3:190290082-190290104 GACACAGATGTCTCTTTGCTGGG + Intergenic
971450459 4:26795590-26795612 CACCATGATGGCTCTTCTCTAGG + Intergenic
974164862 4:58188791-58188813 CCCACTGATGCCACCTTTCTTGG + Intergenic
974753825 4:66177442-66177464 CACCCTGAAGCATCTTTTATTGG + Intergenic
976033725 4:80790621-80790643 CCCAGTGATGGCCCTTTTCTGGG - Intronic
977170533 4:93756483-93756505 CATTCTGAAGCCTCTTCTCTTGG + Intronic
977777147 4:100934541-100934563 CATCCTGAAGCCTCTTTTCTTGG + Intergenic
977982016 4:103335591-103335613 CATTCTGAAGCCTCTTCTCTTGG + Intergenic
978672461 4:111267049-111267071 CTCTCTGATTCGTCTTTTCTTGG + Intergenic
979233714 4:118375580-118375602 CAGACTAATACATCTTTTCTTGG + Intergenic
979479467 4:121199725-121199747 AAGAATGATGCCTCTATTCTGGG - Intronic
979514063 4:121586778-121586800 AACATTGATGCCCCTCTTCTAGG + Intergenic
983032030 4:162814637-162814659 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
983428065 4:167612461-167612483 GAGACTGATTCCCCTTTTCTGGG - Intergenic
987628320 5:20432595-20432617 CACTCTGAGGCCTCTCTCCTGGG + Intronic
987776153 5:22369416-22369438 CACTTTTATGCCTGTTTTCTAGG - Intronic
987874636 5:23665270-23665292 CACACAGATGCCTCATTTGAAGG + Intergenic
988130941 5:27105515-27105537 TATTCTGATGCCTCTCTTCTGGG - Intronic
990364362 5:55054806-55054828 AACCCTCATGCCCCTTTTCTGGG - Intergenic
990389162 5:55300939-55300961 CATTCTGAGGCCTCTTCTCTTGG + Intronic
990731523 5:58814126-58814148 GACTGTGAAGCCTCTTTTCTAGG - Intronic
992331624 5:75722843-75722865 AACACTGATGACTCTTGTCCAGG + Intergenic
993699102 5:91097264-91097286 CACCCTGGGGCCTCTTTTATAGG + Intronic
996072682 5:119151816-119151838 TACACTGATAACTTTTTTCTTGG + Intronic
999023212 5:148193624-148193646 CACACTCATGTCTATTTTCATGG + Intergenic
999301485 5:150493525-150493547 AAAACTGATGCCTGTTTCCTTGG + Intronic
999589664 5:153131076-153131098 GACACTAATCTCTCTTTTCTGGG + Intergenic
1000020496 5:157314489-157314511 CACACTGACCTCTCTTTCCTTGG + Intronic
1001072826 5:168601533-168601555 CACTCTGAGGCCTCTTCTCTTGG + Intergenic
1001636705 5:173215272-173215294 CACAATGATGCCATTTTTATTGG - Intergenic
1001853184 5:174987274-174987296 CTCTCTGATCCCCCTTTTCTTGG - Intergenic
1001978659 5:176022029-176022051 CATTCTGAGGCCTCTTCTCTTGG - Intronic
1002238758 5:177821733-177821755 CATTCTGAGGCCTCTTCTCTTGG + Intergenic
1003751258 6:9059577-9059599 CATACTGATGCTTCTGTTGTTGG + Intergenic
1003908564 6:10723456-10723478 CATAGTGTTGCCTCGTTTCTTGG + Intronic
1004148819 6:13095082-13095104 CATTCTGAGGCCTCTTCTCTTGG - Intronic
1005885662 6:30095842-30095864 CACTCTGAAGCTTGTTTTCTTGG - Intergenic
1005944528 6:30585722-30585744 CCCACTCAGGCCTCTTTTCGAGG - Intronic
1006190400 6:32204106-32204128 CACACTTGTGCCCCTTGTCTTGG + Intronic
1006560377 6:34906195-34906217 CACACTGATGCACCTTTCCTTGG - Intronic
1007085762 6:39143769-39143791 CACTCAGAAGCCTCTGTTCTTGG + Intergenic
1007421484 6:41722456-41722478 CACACCCCTGCCCCTTTTCTGGG - Intronic
1007805680 6:44444034-44444056 CAGACTGTTGTCTCTATTCTTGG + Intronic
1008515207 6:52312365-52312387 CATCCTGAGGCCTCTTCTCTTGG - Intergenic
1008723715 6:54391229-54391251 CACCCTCATGCATATTTTCTAGG - Intergenic
1008880245 6:56374248-56374270 ATCATGGATGCCTCTTTTCTTGG - Intronic
1009451781 6:63809896-63809918 CACAATAATGCCTTATTTCTCGG - Intronic
1009561180 6:65245822-65245844 GACACTGAGGCCTCTTTTTCTGG + Intronic
1010577310 6:77548429-77548451 CAGAATGATGTCTTTTTTCTAGG + Intergenic
1011264803 6:85504512-85504534 CATACTGAGGCCTATTCTCTTGG - Intergenic
1013620221 6:111880528-111880550 CACAGTGATTCCTCTCTTCTGGG + Intergenic
1013728951 6:113139613-113139635 TACACCTATGCCTCTTTTTTTGG - Intergenic
1014272480 6:119349610-119349632 GAGACTGCTGCCTCTTTCCTAGG + Exonic
1014905069 6:127016010-127016032 CATTCTGAGGCCTCTTCTCTTGG + Intergenic
1016808618 6:148237986-148238008 CACCCTGATGCCCATTTTCAGGG - Intergenic
1016911058 6:149199738-149199760 CATTCTGAGGCCTCTTCTCTTGG - Intergenic
1017647894 6:156555817-156555839 CCCACTGAGGCCTCTTTTGCTGG - Intergenic
1018142724 6:160855670-160855692 CTCACTGTTGCCTTTTCTCTGGG + Intergenic
1019056116 6:169224736-169224758 CACACTCGTGCCACTTTTGTTGG + Intronic
1021861242 7:24907923-24907945 CACACTGAGAACTCTTTCCTTGG - Intronic
1021987326 7:26109609-26109631 CTCTCTGATGACACTTTTCTGGG - Intergenic
1022503099 7:30894709-30894731 CACACTGATGCTTCTCTCCAGGG + Intergenic
1024352302 7:48378779-48378801 CACACGGATGTACCTTTTCTAGG + Intronic
1026276680 7:68884936-68884958 CATTCTCAGGCCTCTTTTCTTGG + Intergenic
1026745406 7:73007500-73007522 CCCACTGATTTCTCTTTTCATGG + Intergenic
1026749056 7:73035430-73035452 CCCACTGATTTCTCTTTTCATGG + Intergenic
1026752704 7:73063575-73063597 CCCACTGATTTCTCTTTTCATGG + Intergenic
1026756355 7:73091707-73091729 CCCACTGATTTCTCTTTTCATGG + Intergenic
1027031515 7:74892173-74892195 CCCACTGATTTCTCTTTTCATGG + Intergenic
1027091050 7:75301718-75301740 CCCACTGATTTCTCTTTTCATGG - Intergenic
1027094695 7:75329690-75329712 CCCACTGATTTCTCTTTTCATGG - Intergenic
1027098336 7:75357596-75357618 CCCACTGATTTCTCTTTTCATGG - Intergenic
1027196766 7:76035983-76036005 CACAGGGATGCATCTTCTCTTGG - Intronic
1027324646 7:77037993-77038015 CCCACTGATTTCTCTTTTCATGG + Intergenic
1027737021 7:81945379-81945401 CCCACTCCTGCCTCTTCTCTTGG - Intergenic
1028165919 7:87538482-87538504 CAAACTGATGCCTCTTAGCCAGG + Intronic
1028420508 7:90627594-90627616 CAGATTCATGTCTCTTTTCTAGG - Intronic
1028923152 7:96328743-96328765 CCCCCTGAGGCCTCTCTTCTGGG + Intergenic
1029399445 7:100334489-100334511 CCCACTGATTTCTCTTTTCATGG - Intergenic
1034824908 7:154253157-154253179 GAGACTGTTGCCTTTTTTCTTGG - Intronic
1034860892 7:154593737-154593759 CACACGCATGGCTCTGTTCTAGG + Intronic
1035523566 8:294219-294241 CTCTCTCATGCCTCTTTCCTTGG - Intergenic
1037205112 8:16307928-16307950 CACACTGATGCCTGTTGAGTGGG + Intronic
1037602286 8:20407205-20407227 TATTCTGAGGCCTCTTTTCTTGG - Intergenic
1038556537 8:28523374-28523396 CACTCTGCAGCCTCTTTTATAGG + Intronic
1038611335 8:29062270-29062292 CACCCTGATCCCTCTAGTCTAGG - Intronic
1038657798 8:29469969-29469991 CTCTCTGAAGCCTCTTTTATAGG - Intergenic
1040292904 8:46134550-46134572 CACCCTGTTGTCTCTTTTATGGG + Intergenic
1040314622 8:46254460-46254482 CACACAGTTGTCTCTGTTCTGGG - Intergenic
1040561007 8:48523495-48523517 CACAGAGGAGCCTCTTTTCTGGG + Intergenic
1041389365 8:57335405-57335427 CACAAGGATGCCTTTTTTCATGG - Intergenic
1041694513 8:60721370-60721392 CATTCTGAGGCCTCTTCTCTTGG - Intronic
1043238949 8:77906582-77906604 CACAATGTTGCCTCTTTAATGGG - Intergenic
1043609841 8:82048848-82048870 CACACTGGTGGCTCTTTTCTTGG + Intergenic
1044569101 8:93698488-93698510 CACTCTGATCCCTCTAGTCTAGG + Intergenic
1044630656 8:94275044-94275066 CAGACCCATGGCTCTTTTCTGGG - Intergenic
1044717664 8:95115299-95115321 CATACAGATCCATCTTTTCTTGG - Intronic
1044949393 8:97420564-97420586 CACACTGGTTCCAGTTTTCTTGG - Intergenic
1046310817 8:112434697-112434719 CACATTGATGGTTCCTTTCTAGG - Intronic
1048222116 8:132551696-132551718 CACACTTATACCTCTGGTCTGGG + Intergenic
1049461067 8:142728033-142728055 CTCACTGATGCCTTTGTTCGTGG + Intronic
1049466830 8:142755223-142755245 CACACCACTGCCTCTTTTCTGGG + Intergenic
1050322011 9:4462268-4462290 CACACTTATTCCTAATTTCTGGG - Intergenic
1051498347 9:17749950-17749972 CACACTCATGGCTCTTTACTTGG + Intronic
1053387013 9:37700366-37700388 CAGACTGATGCCTCTATTTCTGG + Intronic
1053485830 9:38455438-38455460 CAAAGAGATGCCTCCTTTCTGGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1058580625 9:106452579-106452601 CACTCTGAAGCCTTTTTGCTAGG + Intergenic
1059338327 9:113583096-113583118 GACAGTGATGCTTCTTTTATAGG + Intronic
1059845234 9:118268277-118268299 CACCCTCACTCCTCTTTTCTGGG + Intergenic
1060260449 9:122069791-122069813 CACACTGCTGGGTCTTCTCTGGG - Intronic
1060730346 9:126033234-126033256 CTCCTTGATGGCTCTTTTCTTGG + Intergenic
1061116069 9:128613081-128613103 CACACTGCTGATTCTTTCCTAGG + Intronic
1062731049 9:138109429-138109451 CACTCTTAGGCCTCTTCTCTTGG + Intronic
1185755679 X:2651231-2651253 AACCCTGATTCCTCTTTTCATGG - Intergenic
1185776574 X:2808068-2808090 CACACAGATCCCTGTTTTCAGGG - Intronic
1186144182 X:6608708-6608730 CAAACATCTGCCTCTTTTCTTGG - Intergenic
1187078448 X:15960321-15960343 CCCACCGATGTCTTTTTTCTGGG - Intergenic
1188118301 X:26273230-26273252 TGCACTGATGCTTCTTTTCTAGG + Intergenic
1188294672 X:28432912-28432934 AGCACTGATCCCTCTTTTCTGGG - Intergenic
1188881467 X:35497052-35497074 CACTCTGCTGACTCCTTTCTTGG + Intergenic
1188960145 X:36481516-36481538 CATTCTGATGCCTCTTCTCTTGG + Intergenic
1189172853 X:38926168-38926190 CACACTGTTGCTCCTTTTTTAGG + Intergenic
1189538786 X:41964752-41964774 CATTCTGAGGCCTCTTTGCTTGG - Intergenic
1191233823 X:58118411-58118433 CACACAGGTGTCTCTTTTATTGG - Intergenic
1192735235 X:73844424-73844446 ATCACTGAGGCCTCTTTGCTTGG - Intergenic
1195644353 X:107211854-107211876 CATAATGATACCTATTTTCTTGG + Intronic
1196021604 X:110996734-110996756 CATTCTGAGGCCTCTTTTCTTGG - Intronic
1196415981 X:115471657-115471679 CATTCTGAGGCCTCTTTTCTTGG - Intergenic
1197265133 X:124361287-124361309 CATTCTGAAGCCTCTTCTCTTGG - Intronic
1199174390 X:144768176-144768198 TACACTTATGCCTCTCTTCCTGG + Intergenic
1199522501 X:148752028-148752050 CTCTCTGAAGCCTCTTTTATCGG + Intronic