ID: 1173823536

View in Genome Browser
Species Human (GRCh38)
Location 20:46033135-46033157
Sequence ATTGGTTTTATAACAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 774}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173823534_1173823536 -2 Left 1173823534 20:46033114-46033136 CCAATTTTTAGTCAGGAAGAGAT 0: 1
1: 0
2: 0
3: 14
4: 335
Right 1173823536 20:46033135-46033157 ATTGGTTTTATAACAGAGACAGG 0: 1
1: 0
2: 1
3: 28
4: 774
1173823532_1173823536 4 Left 1173823532 20:46033108-46033130 CCTGGCCCAATTTTTAGTCAGGA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1173823536 20:46033135-46033157 ATTGGTTTTATAACAGAGACAGG 0: 1
1: 0
2: 1
3: 28
4: 774
1173823530_1173823536 7 Left 1173823530 20:46033105-46033127 CCTCCTGGCCCAATTTTTAGTCA 0: 1
1: 1
2: 0
3: 12
4: 123
Right 1173823536 20:46033135-46033157 ATTGGTTTTATAACAGAGACAGG 0: 1
1: 0
2: 1
3: 28
4: 774
1173823533_1173823536 -1 Left 1173823533 20:46033113-46033135 CCCAATTTTTAGTCAGGAAGAGA 0: 1
1: 0
2: 1
3: 17
4: 333
Right 1173823536 20:46033135-46033157 ATTGGTTTTATAACAGAGACAGG 0: 1
1: 0
2: 1
3: 28
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173823536 Original CRISPR ATTGGTTTTATAACAGAGAC AGG Intronic
900347652 1:2217458-2217480 ATTGTATTTTTAGCAGAGACGGG - Intergenic
901496745 1:9626733-9626755 ATTGTATTTTTAGCAGAGACGGG - Intergenic
901517593 1:9759453-9759475 ATTGTATTTTTAGCAGAGACGGG + Intronic
901518634 1:9766484-9766506 TTTGTATTTATAATAGAGACGGG - Intronic
901555216 1:10026441-10026463 TTTGGTTTTTTAGTAGAGACGGG + Intergenic
902758451 1:18565122-18565144 AGTGGCTTTTTAAAAGAGACAGG - Intergenic
903092798 1:20937609-20937631 AATGGTTTTATATCTGATACAGG + Intronic
903426783 1:23259390-23259412 ATTTTTTTTTTATCAGAGACAGG - Intergenic
903903551 1:26666614-26666636 TTTGTATTTTTAACAGAGACAGG + Intergenic
904184657 1:28694365-28694387 ATTTTTTTTTTAATAGAGACGGG + Intronic
904375328 1:30077812-30077834 ATTGGTCTTAAGACAGAGAAAGG + Intergenic
904725711 1:32546270-32546292 ATTATATTTTTAACAGAGACAGG - Intronic
905067621 1:35196704-35196726 TTTGTATTTTTAACAGAGACAGG + Intergenic
905406038 1:37733062-37733084 TTTGTTTTTTTAATAGAGACTGG + Intronic
905965285 1:42088369-42088391 ATTGGGTATATAACACAGATAGG - Intergenic
906417706 1:45634136-45634158 ACTGGTTTGGTAACAGAGATTGG + Exonic
906482967 1:46212452-46212474 TTTGTATTTTTAACAGAGACGGG + Intronic
906996350 1:50798311-50798333 ATTTGTTTTATTACCCAGACAGG - Intronic
907105910 1:51882397-51882419 TTTGGATTTTTAGCAGAGACGGG - Intergenic
907406355 1:54255898-54255920 TTTGTATTTATAATAGAGACAGG - Intronic
907480040 1:54739190-54739212 ATTATTTTTATAATAGAGACAGG + Intronic
907547087 1:55271594-55271616 TTTGCATTTTTAACAGAGACAGG + Intergenic
908303216 1:62783416-62783438 TTTAATTTTTTAACAGAGACGGG + Intergenic
909796719 1:79748670-79748692 TTTGTATTTTTAACAGAGACGGG + Intergenic
910303432 1:85734072-85734094 TTTGGATTTTTAATAGAGACGGG + Intronic
910763388 1:90757277-90757299 TTTGTATTTTTAACAGAGACGGG - Intergenic
911037371 1:93565235-93565257 TTTGTATTTTTAACAGAGACGGG + Intronic
911256942 1:95644181-95644203 AGAGTTTTTATAAGAGAGACAGG - Intergenic
911611682 1:99965333-99965355 ATTGGTTTCATCTCAGAGTCAGG - Intergenic
911953595 1:104208787-104208809 TTTGTATTTTTAACAGAGACGGG - Intergenic
912327002 1:108775411-108775433 ATTGTTTTTATCACAAAGAAAGG - Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
913578662 1:120203932-120203954 TTTGTATTTTTAACAGAGACAGG - Intergenic
913629511 1:120694429-120694451 TTTGTATTTTTAACAGAGACAGG + Intergenic
914560591 1:148815375-148815397 TTTGTATTTTTAACAGAGACAGG - Intronic
914612243 1:149314840-149314862 TTTGTATTTTTAACAGAGACAGG + Intergenic
914643707 1:149634540-149634562 TTTGTATTTTTAACAGAGACGGG + Intergenic
914739097 1:150448338-150448360 TTTGGTTTTTTAGTAGAGACAGG + Intronic
915014716 1:152721952-152721974 ATTGGTTTTGTACAAGAGAGAGG + Intergenic
915415839 1:155742179-155742201 TTTGTATTTATAGCAGAGACGGG + Intergenic
915688422 1:157661140-157661162 ATTGCTTTTATCAAAAAGACAGG - Intergenic
915692538 1:157704042-157704064 ATTTGTTTAGTAAGAGAGACGGG + Intergenic
915704865 1:157834062-157834084 ATTAGATTTATAAAATAGACGGG - Intronic
915819891 1:159011210-159011232 ATTGTATTTTTAATAGAGACAGG - Intronic
916174652 1:162027628-162027650 TTTGTATTTTTAACAGAGACAGG - Intergenic
916248953 1:162717205-162717227 TTTGTATTTCTAACAGAGACGGG + Intronic
916709787 1:167394189-167394211 TTTGTATTTTTAACAGAGACGGG + Intronic
917604431 1:176612220-176612242 TTTGGATTTTTAGCAGAGACGGG - Intronic
918025496 1:180740922-180740944 AATGCCTTTATAAAAGAGACAGG - Intronic
918059761 1:181050818-181050840 ATTTTTTTTTTAATAGAGACAGG - Intronic
918298859 1:183184183-183184205 AATGGATTTACAACAGCGACTGG + Intergenic
918679015 1:187328078-187328100 ATTTTTTTTTTAATAGAGACGGG - Intergenic
919104808 1:193136042-193136064 ATTTTTTTTTTAATAGAGACAGG + Intronic
919756383 1:201068697-201068719 TTTGTATTTTTAACAGAGACAGG - Intronic
919846549 1:201646426-201646448 ATTGCTTTTTTCACAGGGACAGG + Intronic
919955938 1:202415965-202415987 ATTTTTTTAATAATAGAGACAGG + Intronic
920330991 1:205208049-205208071 TTTGGATTTTTAATAGAGACGGG + Intronic
920389391 1:205589621-205589643 ATTGTTTTTTTTAGAGAGACAGG + Intronic
920394640 1:205635362-205635384 TTTGGTATTTTAACAGAGATGGG - Intergenic
920437018 1:205953588-205953610 ATGGGTATTAGATCAGAGACTGG + Intergenic
921731922 1:218588208-218588230 ATGGGTTAGAGAACAGAGACAGG + Intergenic
922372666 1:224927091-224927113 TTTGTATTTTTAACAGAGACAGG - Intronic
922408638 1:225345834-225345856 ATTGGCTTTATGTCAGAGACGGG - Intronic
922936983 1:229430765-229430787 TTTTGTTTTTTAATAGAGACAGG - Intergenic
923128225 1:231051208-231051230 TTTGGATTTTTAATAGAGACAGG - Intergenic
923332900 1:232942130-232942152 AATGCTTTTAGAACAGAGCCTGG + Intergenic
923525094 1:234766555-234766577 TTTGTATTTTTAACAGAGACAGG + Intergenic
923830201 1:237547175-237547197 ATTGTATTTTTAATAGAGACTGG + Intronic
924004748 1:239596627-239596649 ATTAGTTTTAAATCAGAGAATGG + Intronic
924460659 1:244255640-244255662 TTTGGCTTTTTTACAGAGACAGG - Intergenic
924598962 1:245471303-245471325 ATTGTATTTATAGTAGAGACGGG + Intronic
924762477 1:247001388-247001410 TTTTTTTTTAAAACAGAGACAGG - Intronic
924880930 1:248161977-248161999 ATTTTTTTTATAGTAGAGACGGG + Intergenic
1063217638 10:3938642-3938664 TTTGTATTTTTAACAGAGACAGG - Intergenic
1063412997 10:5851124-5851146 GTTTGTTTTTTAGCAGAGACGGG + Intergenic
1064110166 10:12531751-12531773 ATTGCTTAGAAAACAGAGACAGG - Intronic
1064560738 10:16593307-16593329 ATTGGGTTTATTTGAGAGACAGG + Exonic
1064673546 10:17739371-17739393 TTTGTTTTTTTAAAAGAGACAGG + Intergenic
1066041388 10:31551365-31551387 ATTGGTTGTTTAAAAGAGCCTGG + Intergenic
1066061477 10:31727403-31727425 ATTGGTTTCATAACTGTGATAGG + Intergenic
1066379618 10:34890213-34890235 ATTGTATTTTTAGCAGAGACGGG + Intergenic
1066630209 10:37452124-37452146 TTTGTATTTTTAACAGAGACGGG + Intergenic
1067103468 10:43349908-43349930 ATTTGTATTTTTACAGAGACAGG - Intergenic
1068703718 10:60049228-60049250 ATAGGTTTTATAACTGAGGAAGG - Intronic
1068877540 10:62012527-62012549 CTTTGTTTTTTAATAGAGACAGG - Intronic
1069015013 10:63419962-63419984 ATTGTATTTTTAATAGAGACGGG - Intronic
1069216156 10:65823876-65823898 AATGGTTTTATTACATAGCCTGG - Intergenic
1069937475 10:71927748-71927770 ATTTGTTTTGTTTCAGAGACAGG + Intergenic
1070073357 10:73111149-73111171 TTTGTATTTTTAACAGAGACGGG + Intronic
1070114264 10:73513986-73514008 TTTGTATTTATAATAGAGACAGG + Intronic
1070165973 10:73898303-73898325 TTTGGATTTTTAATAGAGACGGG - Intergenic
1070299197 10:75190606-75190628 TTTGCATTTTTAACAGAGACGGG - Intergenic
1070626868 10:78057211-78057233 TTTTGTTTTTTAATAGAGACAGG - Intergenic
1071810884 10:89179601-89179623 TTTGGATTTTTAATAGAGACGGG - Intergenic
1072146506 10:92644488-92644510 ATTGTATTTTTAATAGAGACAGG + Intronic
1072201999 10:93168568-93168590 TTTGTATTTTTAACAGAGACGGG + Intergenic
1072238064 10:93470055-93470077 TTTGTTTTTTTAGCAGAGACTGG - Intronic
1072838688 10:98745027-98745049 TTTGTATTTTTAACAGAGACGGG - Intronic
1072993455 10:100221261-100221283 TTTGTATTTTTAACAGAGACGGG - Intronic
1073973245 10:109069300-109069322 AGTGGTCTTATAAAAGAGGCTGG - Intergenic
1074589712 10:114801240-114801262 ATTTTTTTTTTAATAGAGACAGG - Intergenic
1074870411 10:117571569-117571591 TTTGTATTTATAATAGAGACGGG + Intergenic
1074979828 10:118610567-118610589 CTTGGTTTTATAAAGGAAACAGG - Intergenic
1075056232 10:119220661-119220683 CTTGGATTTTTAATAGAGACGGG - Intronic
1075380510 10:122014912-122014934 TTTAGTTTTATAACAGAGCATGG - Intronic
1075698581 10:124453458-124453480 TTTGTGTTTTTAACAGAGACAGG + Intergenic
1075860625 10:125673537-125673559 TTTGTATTTATAGCAGAGACGGG - Intronic
1075965603 10:126609229-126609251 TTTGTATTTTTAACAGAGACGGG - Intronic
1077596942 11:3541111-3541133 ATTGTATTTTTAATAGAGACAGG - Intergenic
1078016890 11:7622849-7622871 TTTGGTTTTATGACAGAGGGCGG - Intronic
1078494543 11:11802723-11802745 TTTGGATTTTTAGCAGAGACAGG + Intergenic
1079068940 11:17326169-17326191 TTTGTATTTATAATAGAGACAGG + Intronic
1079212456 11:18474823-18474845 ATTATTTTTTTAATAGAGACAGG - Intronic
1079226565 11:18611269-18611291 TTTTGTTTTTTAACAGAGATGGG - Intronic
1080620641 11:33984633-33984655 ATTTGTTTTTTTTCAGAGACGGG - Intergenic
1080784918 11:35466552-35466574 TTTGTATTTTTAACAGAGACGGG - Intronic
1081287829 11:41293767-41293789 TTTGTATTTTTAACAGAGACAGG + Intronic
1081928176 11:46848093-46848115 ATTGTATTTTTAACAGAGATGGG + Intergenic
1082094201 11:48114264-48114286 TTTGTATTTTTAACAGAGACGGG - Intronic
1082822870 11:57556411-57556433 TTTGCATTTTTAACAGAGACAGG - Intronic
1082829373 11:57603976-57603998 TTTGTATTTTTAACAGAGACAGG - Intronic
1083329231 11:61889822-61889844 ATTTGTTTAAAAATAGAGACAGG - Intronic
1083908073 11:65687071-65687093 TTTGTATTTTTAACAGAGACAGG - Intergenic
1084252865 11:67915065-67915087 ATTGTATTTTTAATAGAGACAGG - Intergenic
1084820000 11:71680959-71680981 ATTGTATTTTTAATAGAGACAGG + Intergenic
1084830869 11:71768354-71768376 CTTGTATTTTTAACAGAGACAGG - Intergenic
1085111455 11:73893563-73893585 TTTGTATTTTTAACAGAGACGGG - Intronic
1085218876 11:74855959-74855981 TTTTGTTTTTTATCAGAGACAGG - Intronic
1085260391 11:75201193-75201215 ATTGTATTTTTAGCAGAGACGGG + Intronic
1086138503 11:83467575-83467597 TTTGGATTTTTAGCAGAGACAGG - Intronic
1086288858 11:85281678-85281700 ATGGCTTTTATAAAAAAGACAGG + Intronic
1087003988 11:93450696-93450718 TTTGTATTTTTAACAGAGACGGG - Intergenic
1087050926 11:93885668-93885690 TTTGTATTTTTAACAGAGACGGG + Intergenic
1087559736 11:99772766-99772788 AATGGTTTTATAAGAGAGAATGG + Intronic
1088667186 11:112104924-112104946 TTTGTATTTTTAACAGAGACGGG - Intronic
1088870649 11:113887629-113887651 TTTGTATTTTTAACAGAGACAGG - Intergenic
1089016887 11:115172748-115172770 TTTTTTTTTTTAACAGAGACAGG + Exonic
1089246893 11:117128234-117128256 TTTGTATTTTTAACAGAGACAGG + Intergenic
1089276549 11:117340197-117340219 TTTGTATTTTTAACAGAGACGGG + Intronic
1089393214 11:118116125-118116147 TTATGTTTTTTAACAGAGACAGG + Intronic
1090177148 11:124660887-124660909 ATTCGGTTTATTACAGAGGCTGG - Intronic
1090184703 11:124729465-124729487 ATTGGTTTTAAAAAAGTGATAGG - Intergenic
1090397685 11:126429961-126429983 TTTGGATTTTTAATAGAGACGGG - Intronic
1090861759 11:130659959-130659981 ATTTGTTTTTTAAGGGAGACAGG - Intergenic
1090881607 11:130837728-130837750 TTTTTTTTTTTAACAGAGACAGG + Intergenic
1091312286 11:134583172-134583194 TTTGTATTTTTAACAGAGACGGG - Intergenic
1091497631 12:986233-986255 CTTGTTTTTAAAATAGAGACAGG + Intronic
1091533996 12:1388174-1388196 TTTGTATTTTTAACAGAGACAGG - Intronic
1091741809 12:2964641-2964663 TTTGTATTTTTAACAGAGACAGG + Intronic
1092222707 12:6726007-6726029 TTTGTATTTTTAACAGAGACAGG - Intronic
1092379640 12:7984872-7984894 TTTGTATTTTTAACAGAGACAGG - Intergenic
1092423110 12:8349870-8349892 ATTGTATTTTTAATAGAGACAGG - Intergenic
1092729574 12:11516607-11516629 ATTCATTTCATAACAGATACAGG - Intergenic
1092849688 12:12615366-12615388 TTTTTTTTTTTAACAGAGACAGG + Intronic
1093514353 12:19968369-19968391 TTTGTATTTTTAACAGAGACGGG + Intergenic
1093871538 12:24298076-24298098 ATTTGTTTTATTTCTGAGACAGG + Intergenic
1094089699 12:26634711-26634733 TTTGTATTTTTAACAGAGACAGG - Intronic
1094634518 12:32212593-32212615 CTTTGTATTTTAACAGAGACGGG + Intronic
1095277661 12:40307951-40307973 TTTGGATTTTTAATAGAGACGGG + Intronic
1095429958 12:42122416-42122438 ATTGTATTTTTAATAGAGACGGG - Intronic
1095653442 12:44641432-44641454 ATTGGCTTTATGTCAGATACTGG - Intronic
1095726023 12:45454100-45454122 TTTGGATTTTTAATAGAGACAGG - Intergenic
1096097419 12:48945271-48945293 TTTGGGTTTTTAATAGAGACGGG - Intronic
1096171010 12:49469717-49469739 ATTTGTATTTTAACAGAGATGGG - Intronic
1096740377 12:53689280-53689302 ATTATTTTTAAAATAGAGACAGG - Intergenic
1096872277 12:54600755-54600777 ATTGTTTTTATTTTAGAGACAGG + Intergenic
1096973861 12:55687358-55687380 TTTGTATTTTTAACAGAGACAGG + Intronic
1097338544 12:58411985-58412007 ATTTGTTTTAGAATAGAGATGGG + Intergenic
1097682622 12:62663140-62663162 ATTGTTTTTATTACAGAAACTGG - Intronic
1097920175 12:65063717-65063739 GTTTGTTTTTTAAAAGAGACAGG + Intronic
1098223987 12:68301847-68301869 AATTTTTTTGTAACAGAGACAGG + Intronic
1098300784 12:69052204-69052226 ATTTTTTTTTTAATAGAGACGGG + Intergenic
1098368358 12:69731140-69731162 ATTGTTTTTATAAATAAGACTGG + Intergenic
1098857070 12:75665100-75665122 TTTGTATTTTTAACAGAGACAGG - Intergenic
1098871969 12:75826531-75826553 ATTGGTTTTAGATAAGAGAAAGG - Intergenic
1098957513 12:76702860-76702882 ATTTTTTTTTTAGCAGAGACGGG + Intergenic
1099574796 12:84364735-84364757 ATTTTTTTTTTAGCAGAGACGGG + Intergenic
1099974193 12:89529212-89529234 ATTTTTTTTTTAATAGAGACTGG + Intergenic
1100432424 12:94542487-94542509 TTTGTTTTTTGAACAGAGACAGG - Intergenic
1100527301 12:95431801-95431823 TTTTTTTTTATAATAGAGACAGG - Intergenic
1100917920 12:99447923-99447945 ATGGCTTTTATAAAAAAGACAGG + Intronic
1100987087 12:100212641-100212663 TTTAATTTTATAATAGAGACAGG - Intronic
1101197275 12:102397027-102397049 TTTGGATTTTTAATAGAGACGGG - Intronic
1101609602 12:106278797-106278819 ATTGATGCTATAATAGAGACAGG + Intronic
1101729540 12:107415533-107415555 TTTGGTTTTTTAGTAGAGACGGG - Intronic
1102087471 12:110154457-110154479 TTTGTGTTTTTAACAGAGACAGG - Intronic
1102170509 12:110838899-110838921 TTTTTTTTTTTAACAGAGACAGG - Intergenic
1102342682 12:112135968-112135990 GTTGTATTTTTAACAGAGACAGG - Intronic
1102364004 12:112315722-112315744 TTTGTTTTTTTAAAAGAGACAGG + Intronic
1102964899 12:117118469-117118491 ATTGTATTTTTAGCAGAGACTGG - Intergenic
1103023734 12:117556991-117557013 TTTGGATTTTTAATAGAGACAGG - Intronic
1103401140 12:120643601-120643623 ATATATTTTATAATAGAGACAGG + Intronic
1103529891 12:121593747-121593769 TTTTTTTTTTTAACAGAGACAGG - Intergenic
1103676186 12:122657676-122657698 ATTATTTTTATAGTAGAGACGGG - Intergenic
1103924851 12:124417886-124417908 TTTGTATTTATAATAGAGACAGG - Intronic
1104230088 12:126876334-126876356 ATTTTTTTTTTAGCAGAGACAGG - Intergenic
1104570960 12:129925578-129925600 TATGATTTTATAATAGAGACTGG - Intergenic
1107608004 13:42081399-42081421 TTTGTGTTTTTAACAGAGACAGG + Intronic
1108044883 13:46374248-46374270 TTTGTATTTTTAACAGAGACGGG + Intronic
1109637438 13:65141011-65141033 TTTGTATTTTTAACAGAGACAGG - Intergenic
1109706489 13:66099917-66099939 ATTTTTTTTTTAATAGAGACAGG - Intergenic
1110425386 13:75361549-75361571 TTTTGTTTTTTAATAGAGACGGG + Intronic
1110609096 13:77469194-77469216 ATTATTTTTATAACAGAAAATGG - Intergenic
1110704660 13:78591239-78591261 ATTGGATATGTAAAAGAGACAGG - Intergenic
1111285082 13:86080104-86080126 ATTGGTTATATAACAGACAGAGG - Intergenic
1111530051 13:89525011-89525033 TTTGTATTTTTAACAGAGACAGG + Intergenic
1111933217 13:94532889-94532911 TTTCGTGTTATAACAGAGAGAGG - Intergenic
1111940145 13:94599684-94599706 TTTGGATTTTTAGCAGAGACGGG - Intergenic
1112469717 13:99676467-99676489 ATTGTTTTTTTAGTAGAGACAGG + Intronic
1112912351 13:104503080-104503102 ATTGGTTGAATAACAGATCCTGG + Intergenic
1113112731 13:106841405-106841427 TTTGTATTTTTAACAGAGACGGG + Intergenic
1113990942 14:16026676-16026698 ATTTGTTTTATACCAGTGGCTGG - Intergenic
1114505591 14:23209979-23210001 TTTGTATTTTTAACAGAGACAGG - Intronic
1114724930 14:24925995-24926017 ATTGGATGTAAAACAAAGACAGG + Intronic
1114987748 14:28251514-28251536 ATATGTTTTAGAAAAGAGACTGG - Intergenic
1115557047 14:34552179-34552201 ATTTTTTTTAAAATAGAGACAGG - Intergenic
1115572255 14:34677601-34677623 TTTGGATTTTTAATAGAGACGGG - Intergenic
1116343085 14:43751990-43752012 TTTGGATTTTTAATAGAGACAGG + Intergenic
1116600308 14:46913248-46913270 AATGTTATTATAATAGAGACAGG - Intronic
1116630372 14:47323452-47323474 ATTTGTTTTTTAGTAGAGACAGG - Intronic
1116813981 14:49566727-49566749 TTTGTTTTTTTAATAGAGACGGG - Intergenic
1116815333 14:49578730-49578752 TTTGTATTTTTAACAGAGACAGG + Intronic
1116989812 14:51263282-51263304 AGTGGTGTTATAACTCAGACTGG + Intergenic
1117933173 14:60869210-60869232 TTTGGTATTTTAATAGAGACGGG + Intronic
1117979754 14:61330711-61330733 GTTGGTTTCATAACAGGGAGTGG - Intronic
1118115470 14:62771451-62771473 TTTTGTTTTGTAATAGAGACGGG - Intronic
1118545628 14:66885009-66885031 AATGGTTTTATAACTGATATTGG + Intronic
1118546072 14:66890591-66890613 ATTGGTCTCATACCAAAGACAGG + Intronic
1118614258 14:67564461-67564483 ATTCTTTTTTTAACTGAGACAGG + Intronic
1119301954 14:73578653-73578675 ATTGATTTTAAAATAGAGGCCGG + Intergenic
1119766579 14:77193661-77193683 TTTGTATTTTTAACAGAGACGGG - Intronic
1120977560 14:90262609-90262631 TTTGGATTTTTAGCAGAGACGGG - Intronic
1121557823 14:94851552-94851574 ATTGTATTTTTAGCAGAGACAGG + Intergenic
1122668555 14:103352165-103352187 TTTTTTTTTTTAACAGAGACAGG - Intergenic
1123044546 14:105504929-105504951 TTTGTATTTTTAACAGAGACGGG + Intergenic
1202892185 14_KI270722v1_random:168973-168995 TTTTGTTTTTTAATAGAGACGGG - Intergenic
1124336965 15:28864805-28864827 ATTACTTTTAAAACAGAGACAGG + Intergenic
1124618217 15:31257795-31257817 TTTGGATTTTTAATAGAGACGGG - Intergenic
1125370758 15:38973851-38973873 ATTGGTGTGATAACTAAGACTGG + Intergenic
1125452535 15:39824099-39824121 ATTGGTTGTTTAAAAGAGCCTGG + Intronic
1125661859 15:41400708-41400730 TTTGGATTTTTAATAGAGACAGG + Intronic
1125917067 15:43497220-43497242 ATTGTATTTTTAATAGAGACGGG - Intronic
1126976867 15:54192663-54192685 ATTGGTTTTATAAATCAGAATGG + Intronic
1127234868 15:57038258-57038280 ATTTTTTTTTTAACAGAGATGGG - Intronic
1127473101 15:59308043-59308065 TTTTGTTTTTTAATAGAGACAGG - Intronic
1127845738 15:62868947-62868969 TTTTGTTTTATTACAGAGATGGG - Intergenic
1127935800 15:63636440-63636462 TTTGTATTTTTAACAGAGACAGG + Intronic
1128200521 15:65802562-65802584 GTTTGTTTTTTAATAGAGACAGG - Intronic
1128269633 15:66297418-66297440 ATAAGTTTTTTAATAGAGACAGG - Intronic
1129020899 15:72517273-72517295 ATTATTTTTTTAAAAGAGACTGG + Intronic
1129699267 15:77758244-77758266 ATTGATTTTATTTCAGAGACAGG - Intronic
1130128521 15:81115857-81115879 TTTTTTTTTTTAACAGAGACAGG + Intronic
1131705373 15:94989830-94989852 GCTGGATTTATACCAGAGACAGG + Intergenic
1132283630 15:100642863-100642885 TTTGTATTTTTAACAGAGACAGG - Intronic
1132716182 16:1291169-1291191 TTTGTATTTATAGCAGAGACAGG + Intergenic
1132730298 16:1357684-1357706 TTTGTGTTTTTAACAGAGACGGG + Intronic
1133179459 16:4042093-4042115 TTTGTTTTTTTAGCAGAGACGGG + Intronic
1133198307 16:4186389-4186411 TTTTGTTTTTTAACGGAGACAGG + Intergenic
1133466111 16:6028498-6028520 TTTTTTTTTTTAACAGAGACAGG - Intronic
1133549679 16:6841963-6841985 ATTTTTTTTTTAATAGAGACGGG - Intronic
1134102945 16:11465296-11465318 TTTGTATTTTTAACAGAGACAGG + Intronic
1134164487 16:11919282-11919304 TTTGTATTTTTAACAGAGACGGG + Intergenic
1134243040 16:12519834-12519856 TTTGTATTTTTAACAGAGACAGG - Intronic
1134256790 16:12618935-12618957 TTTGTATTTATAGCAGAGACGGG - Intergenic
1134621597 16:15693627-15693649 ATTTTTTTTTTAATAGAGACAGG - Intronic
1134627701 16:15734469-15734491 TTTGGATTTATAGTAGAGACAGG + Intronic
1135080528 16:19430839-19430861 ATTGTTTTTATTGCAGAGAGTGG - Intronic
1135111447 16:19693467-19693489 ATTTTTTTTTTAATAGAGACAGG - Intronic
1135725604 16:24851627-24851649 AATGGTTTTATAAAATGGACGGG + Intronic
1136039297 16:27565292-27565314 TTTGCATTTTTAACAGAGACGGG - Intronic
1136174689 16:28508511-28508533 ATTGTGTTTTTAATAGAGACGGG - Intronic
1136346267 16:29678261-29678283 TTTGGTTTTTTAGTAGAGACGGG + Intronic
1136371430 16:29839013-29839035 TTTTGTATTTTAACAGAGACGGG - Intronic
1136709501 16:32224439-32224461 TTTGTATTTTTAACAGAGACGGG - Intergenic
1136758408 16:32704980-32705002 TTTGTATTTTTAACAGAGACGGG + Intergenic
1136809700 16:33165399-33165421 TTTGTATTTTTAACAGAGACGGG - Intergenic
1136816176 16:33275479-33275501 TTTGTATTTTTAACAGAGACGGG - Intronic
1136910119 16:34137801-34137823 ATTTGTTTTATACCAGTGGCTGG - Intergenic
1137629882 16:49935449-49935471 ATTGTATTTTTAATAGAGACAGG - Intergenic
1137742483 16:50794097-50794119 TTTGTATTTTTAACAGAGACAGG + Intronic
1138397695 16:56718421-56718443 TTTGGTTTTTTAGTAGAGACGGG - Intronic
1138993811 16:62423927-62423949 TTTGGATTTATAGTAGAGACAGG + Intergenic
1139456120 16:67078825-67078847 ATTTGTTTTTTAGTAGAGACGGG + Intronic
1139565985 16:67776599-67776621 TTTGTATTTTTAACAGAGACAGG - Intronic
1139831502 16:69802099-69802121 TTTGTATTTTTAACAGAGACAGG + Intronic
1139876003 16:70146445-70146467 TTTGTATTTTTAACAGAGACAGG - Intronic
1140230842 16:73115948-73115970 TTTTGTATTTTAACAGAGACGGG - Intergenic
1140359787 16:74334653-74334675 TTTGTATTTTTAACAGAGACAGG + Intergenic
1140380091 16:74479032-74479054 TTTGGATTTTTAATAGAGACGGG - Intronic
1141430105 16:83967041-83967063 ATTGTATTTTTAATAGAGACGGG + Intergenic
1203060562 16_KI270728v1_random:965314-965336 TTTGTATTTTTAACAGAGACGGG + Intergenic
1142507971 17:377485-377507 AAATGTTTTATAACAGAGATGGG - Intronic
1142519573 17:495366-495388 TTTTGTTTTTTAATAGAGACAGG + Intergenic
1142725224 17:1809046-1809068 ATTTTGTTTTTAACAGAGACAGG + Intronic
1142870640 17:2818007-2818029 TTTGTATTTTTAACAGAGACGGG + Intronic
1143228054 17:5324867-5324889 ATTGCTTTTATCAAAAAGACAGG + Intronic
1144596474 17:16574298-16574320 TTTGTTTTTTTAATAGAGACGGG - Intergenic
1145225176 17:21122707-21122729 TTTGTATTTTTAACAGAGACGGG + Intergenic
1146390326 17:32416178-32416200 TTTGTTTTTTTAATAGAGACAGG + Intergenic
1146483152 17:33221171-33221193 TTTGGATTTACAACAGAGCCAGG - Intronic
1146526804 17:33573735-33573757 TTTGTATTTTTAACAGAGACAGG + Intronic
1146815061 17:35935984-35936006 TTTGTATTTTTAACAGAGACGGG + Intronic
1146898310 17:36562338-36562360 TTTGGATTTTTAATAGAGACGGG + Intronic
1146986421 17:37224028-37224050 TTTGTATTTTTAACAGAGACAGG - Intronic
1147276306 17:39319783-39319805 ATTATTTTTAAAATAGAGACCGG + Intronic
1147362042 17:39936948-39936970 ATTATTTTTTTAATAGAGACGGG - Intergenic
1147705880 17:42424351-42424373 TTTGTATTTGTAACAGAGACGGG - Intergenic
1148500104 17:48083649-48083671 TTTGGATTTTTAGCAGAGACAGG - Intronic
1148881041 17:50727409-50727431 ATTGGTTGTTGAACAGAGCCTGG - Intronic
1148931950 17:51134234-51134256 ATTGTATTTTTAATAGAGACAGG + Intergenic
1150038400 17:61830103-61830125 TTTGTATTTATAATAGAGACAGG + Intronic
1150048587 17:61937060-61937082 TTTGGATTTTTAGCAGAGACGGG + Intergenic
1150160430 17:62893602-62893624 TTTGTATTTATAATAGAGACAGG + Intergenic
1150312064 17:64136820-64136842 TTTGTATTTTTAACAGAGACAGG - Intergenic
1150525213 17:65915610-65915632 ATTGTATTTTTAGCAGAGACAGG - Intronic
1150706786 17:67494369-67494391 TTTGTTTTTTTAATAGAGACAGG + Intronic
1150766117 17:68003548-68003570 ATTTTTTTTATAGTAGAGACAGG + Intergenic
1151281422 17:73077497-73077519 TTTTGTTTTTTGACAGAGACAGG + Intronic
1151614050 17:75196584-75196606 TTTGTATTTTTAACAGAGACGGG - Intergenic
1151781995 17:76253001-76253023 TTTGTATTTTTAACAGAGACGGG + Intergenic
1151863302 17:76782344-76782366 TTTGTATTTATAATAGAGACAGG + Intergenic
1151914548 17:77107913-77107935 ATTTATTTAAAAACAGAGACGGG + Intronic
1152764979 17:82131567-82131589 GTTTGTTTTTTAATAGAGACAGG - Intronic
1152770389 17:82164202-82164224 ATTTTTTTTTTAGCAGAGACAGG - Intronic
1154010228 18:10567984-10568006 TTTGTATTTTTAACAGAGACGGG - Intergenic
1154305824 18:13230103-13230125 AGTGCCTTTATAACAGAGGCCGG + Intronic
1154459553 18:14567309-14567331 AGGGGTTTTATAATAAAGACAGG + Intergenic
1155815397 18:30301712-30301734 ATTGGTTTTATGTAAGAGACAGG - Intergenic
1156054793 18:32988262-32988284 TTTGTATTTATAACAGGGACGGG - Intronic
1156507396 18:37606830-37606852 ATTTTTTTTTTAGCAGAGACAGG + Intergenic
1156684614 18:39629501-39629523 ATTGGTTTTACAACAGTGATTGG - Intergenic
1157260456 18:46172155-46172177 TTTGGTTTTTTAGTAGAGACGGG - Intergenic
1157802265 18:50630358-50630380 TTTGTATTTTTAACAGAGACAGG + Intronic
1157868677 18:51209285-51209307 ACTTTTTTTCTAACAGAGACAGG - Intronic
1158475803 18:57778401-57778423 ATTTTTTTTTTAATAGAGACGGG + Intronic
1158658445 18:59362180-59362202 ATGGGTTTTATAAATGGGACAGG - Intergenic
1158739689 18:60125966-60125988 ATTGGTTATATCAAAGAGATGGG + Intergenic
1158955465 18:62533693-62533715 ATTTTTTTTAAATCAGAGACAGG - Intronic
1159007691 18:63027137-63027159 ATTGTATTTTTAATAGAGACTGG + Intergenic
1159363050 18:67429962-67429984 TTTGGATTTTTAGCAGAGACGGG + Intergenic
1160728784 19:630984-631006 TTTGGATTTCTAATAGAGACGGG - Intronic
1161052928 19:2174513-2174535 TTTGTATTTTTAACAGAGACGGG - Intronic
1161107122 19:2449606-2449628 ATTTGTGTTTTAATAGAGACAGG - Intronic
1161278189 19:3430758-3430780 TTTGGATTTTTAATAGAGACGGG - Intronic
1161753649 19:6115482-6115504 TTTGGGTTTTTAATAGAGACCGG - Intronic
1161865755 19:6831076-6831098 ATTTATTTTTTAATAGAGACAGG - Intronic
1161931182 19:7341475-7341497 TTTGGATTTTTAATAGAGACGGG + Intergenic
1162095097 19:8305532-8305554 TTTGTATTTTTAACAGAGACGGG - Intronic
1162276103 19:9656334-9656356 ATTGTATTTATAGTAGAGACAGG - Intronic
1162319712 19:9963995-9964017 ATTGTATTTTTAGCAGAGACGGG - Intronic
1162632186 19:11937347-11937369 ATTTATTTTATTACAGAGACGGG + Intronic
1162661285 19:12171004-12171026 TTTGTTTTTTTAATAGAGACAGG + Intronic
1162672400 19:12268006-12268028 TTTGTATTTTTAACAGAGACAGG + Intronic
1162839860 19:13348529-13348551 TTTGTATTTTTAACAGAGACTGG - Intronic
1163776428 19:19220895-19220917 TTTGTTTTTCTAATAGAGACAGG - Intronic
1163887534 19:19980440-19980462 TTTGTATTTTTAACAGAGACGGG - Intergenic
1164890443 19:31819336-31819358 TTTGGGTTTTTAATAGAGACGGG - Intergenic
1165209394 19:34221491-34221513 TTTGCTTTTATAATAGAGAACGG + Exonic
1165242329 19:34478826-34478848 ATTTGTATTTTAATAGAGACAGG + Intergenic
1165319468 19:35076436-35076458 TTTGTATTTTTAACAGAGACGGG - Intergenic
1165319705 19:35077586-35077608 CTGGGTTGTATAACAGAGAAAGG - Intergenic
1165383108 19:35494908-35494930 ATTTGTATTTTAATAGAGACGGG - Intronic
1165911773 19:39233208-39233230 ATTTTTTTTTTAATAGAGACAGG + Intergenic
1166013948 19:39966003-39966025 TTTGTATTTTTAACAGAGACGGG + Intergenic
1166065299 19:40354695-40354717 TTTGTATTTTTAACAGAGACAGG + Intronic
1166168025 19:41006157-41006179 ATTTGTTTTAAATTAGAGACGGG + Intronic
1167261088 19:48458579-48458601 TTTGGATTTTTAATAGAGACGGG + Intronic
1167484583 19:49754325-49754347 TTTGGATTTTTAGCAGAGACGGG - Intronic
1167601534 19:50457849-50457871 ATTGTGTTTTTAATAGAGACAGG + Intronic
1167678098 19:50901247-50901269 TTTGTTTTTTTAATAGAGACAGG + Intergenic
1167807288 19:51796903-51796925 AATGGTTTAATCCCAGAGACTGG + Intronic
1167880359 19:52452637-52452659 GTGTGTTTTATAAGAGAGACTGG + Intergenic
1168021450 19:53611910-53611932 TTTGTATTTTTAACAGAGACGGG - Intergenic
1168222134 19:54968220-54968242 GTTGTTTTTAAAATAGAGACAGG + Intronic
1168457155 19:56521463-56521485 TTTGTATTTTTAACAGAGACGGG - Intronic
1168504155 19:56919229-56919251 ATTGTATTTTTAATAGAGACAGG - Intergenic
925249891 2:2423055-2423077 AATGGATTAAAAACAGAGACAGG + Intergenic
925480534 2:4266208-4266230 ATTGCTTTTAGCACTGAGACAGG - Intergenic
925730206 2:6914702-6914724 TTTGTATTTTTAACAGAGACAGG + Intergenic
926100386 2:10112421-10112443 TTTTGTTTTTTAGCAGAGACTGG + Intergenic
926844354 2:17118871-17118893 ATTGATTTTATAAAAGAATCAGG + Intergenic
927160546 2:20254460-20254482 ATTACTTTTATAACAGAAATTGG + Intronic
928166312 2:28974800-28974822 ATTATTTTTTTAATAGAGACAGG + Intronic
928336520 2:30403090-30403112 TTTGGTTTGGTAACAGTGACAGG - Intergenic
928568868 2:32582589-32582611 TTTGTATTTTTAACAGAGACGGG - Intronic
928709124 2:33984953-33984975 ATTGCTTATATTACAGGGACAGG + Intergenic
929363372 2:41121904-41121926 TTTGTATTTTTAACAGAGACAGG + Intergenic
930776319 2:55174783-55174805 CTTTTTTTAATAACAGAGACGGG + Intronic
931347190 2:61457369-61457391 ATTGGGTTTATAACATAATCAGG - Intronic
932338595 2:70944838-70944860 ATTTGTTTTTTAGCAGAGACGGG + Intronic
932395052 2:71438591-71438613 ATTGTATTTATAGTAGAGACAGG + Intergenic
934694589 2:96390304-96390326 ATTGATTTTTTTTCAGAGACAGG - Intergenic
936592183 2:113814640-113814662 TTTGTTTTTTTAATAGAGACAGG - Intergenic
937123165 2:119454680-119454702 TTTGTTTTTTTAATAGAGACAGG - Intronic
938562240 2:132483569-132483591 TTTGGTGTTATACCAGAGCCTGG + Intronic
938820360 2:134951667-134951689 TTTTGTTAAATAACAGAGACAGG - Intronic
939384546 2:141478714-141478736 TTTGTTTTTTTAATAGAGACAGG + Intronic
939568574 2:143813621-143813643 ATTTTTTTTTTAATAGAGACGGG - Intergenic
940318674 2:152350871-152350893 TTTGTATTTATAATAGAGACAGG - Intronic
940479159 2:154206172-154206194 ATTTTTTTTATAGTAGAGACGGG + Intronic
941321190 2:164056986-164057008 ATTGTATTTTTAATAGAGACAGG - Intergenic
941603578 2:167567182-167567204 ATTGGTATTAGAACAGTGACTGG + Intergenic
942441712 2:176043617-176043639 TTTGTATTTTTAACAGAGACAGG + Intergenic
942754950 2:179329468-179329490 ATTGTATTTTTAGCAGAGACTGG + Intergenic
943589388 2:189779170-189779192 TTTGTTTTTCTTACAGAGACAGG - Intronic
943782722 2:191843010-191843032 TTTGTATTTTTAACAGAGACAGG - Intronic
943918142 2:193664758-193664780 ATTGTTTTTTTAGTAGAGACTGG - Intergenic
944031537 2:195240473-195240495 TTTGTATTTATAATAGAGACAGG - Intergenic
944183473 2:196922859-196922881 ATTTTTTTTTTAGCAGAGACAGG + Intronic
944219763 2:197291336-197291358 TTTGTGTTTTTAACAGAGACGGG - Intronic
944736449 2:202571138-202571160 ATTTATTTTTTAATAGAGACAGG - Intergenic
944979985 2:205106318-205106340 TTTGTATTTATAGCAGAGACAGG + Intronic
945460651 2:210103925-210103947 ATTGGTATTATAATGGAGACTGG + Intronic
945550723 2:211218867-211218889 ATTGGCCTTATAACTGAGGCAGG + Intergenic
945784328 2:214214339-214214361 TTTGTATTTTTAACAGAGACAGG + Intronic
945985798 2:216352526-216352548 GTTGTTTTTTTAATAGAGACAGG + Intronic
946349007 2:219135804-219135826 ATTTGTTTTCTAAAAGAGACAGG - Intronic
946671993 2:222114944-222114966 TTTGCATTTATACCAGAGACAGG + Intergenic
946738236 2:222775618-222775640 ATATGTTTTATAATAGAGATGGG - Intergenic
947249490 2:228086014-228086036 TTTGGGTTTATAACTGAGGCAGG - Intronic
947662528 2:231880417-231880439 TTTGTATTTTTAACAGAGACAGG + Intergenic
949016589 2:241715962-241715984 TTTGTATTTTTAACAGAGACAGG + Intronic
1168762449 20:358512-358534 ATTTTTTTTTTAAGAGAGACAGG - Intronic
1169169132 20:3449960-3449982 ATTTTTTTTTTAATAGAGACAGG - Intergenic
1169384280 20:5135109-5135131 ACTTATTTTATAATAGAGACAGG + Intronic
1169648606 20:7842197-7842219 ATTGGTTCTGTTACAGAGTCTGG - Intergenic
1169748964 20:8972344-8972366 ATTCTTTTTATAAAAGAAACTGG + Intergenic
1170183740 20:13563674-13563696 TTTTTTTTTTTAACAGAGACAGG + Intronic
1170186023 20:13591752-13591774 ATGGGGTTTATAACATATACAGG + Intronic
1170511734 20:17084603-17084625 TTTGAATTTTTAACAGAGACGGG - Intergenic
1171229729 20:23474544-23474566 TTTGGATTTATAGTAGAGACAGG - Intergenic
1171770943 20:29323033-29323055 ATTTGTTTTATACCAGTGGCTGG + Intergenic
1171905595 20:30896538-30896560 ATTTGTTTTATACCAGTGGCTGG - Intergenic
1172749704 20:37242163-37242185 TTTGGTTTTTTAGTAGAGACAGG - Intergenic
1172958177 20:38777329-38777351 GTTTGTTTTTTAATAGAGACAGG - Intergenic
1172968249 20:38854408-38854430 ATTGATGTTGTAACAGAAACAGG + Intronic
1173080169 20:39859116-39859138 TTTGTATTTATAGCAGAGACGGG + Intergenic
1173613221 20:44386026-44386048 ATTTTTTTTTTAATAGAGACAGG + Intronic
1173797938 20:45875672-45875694 TTTGTATTTTTAACAGAGACAGG + Intronic
1173823536 20:46033135-46033157 ATTGGTTTTATAACAGAGACAGG + Intronic
1176310954 21:5148592-5148614 TTTGTTTTTATAGTAGAGACGGG - Intronic
1176814597 21:13586029-13586051 AGGGGTTTTATAATAAAGACAGG - Intergenic
1177882376 21:26709534-26709556 TTTTGTTTTTTAGCAGAGACGGG + Intergenic
1178778069 21:35571475-35571497 ATTTGTTTTTTGATAGAGACGGG - Intronic
1179178368 21:39025062-39025084 TTTGTATTTTTAACAGAGACAGG + Intergenic
1179846101 21:44113443-44113465 TTTGTTTTTATAGTAGAGACGGG + Intronic
1180316328 22:11280849-11280871 ATTTGTTTTATACCAGTGGCTGG + Intergenic
1180339005 22:11602632-11602654 ATTTGTTTTATACCAGTGGCTGG - Intergenic
1180789160 22:18564944-18564966 GTTTGTTTTATAAATGAGACAGG - Intergenic
1181032133 22:20153560-20153582 ATTTATTTTAAAACAGAGTCTGG - Intergenic
1181147092 22:20856603-20856625 GTTGGGTTTTTAGCAGAGACAGG + Intronic
1181579434 22:23819500-23819522 TTTGGATTTTTAATAGAGACCGG + Intronic
1181822489 22:25486978-25487000 ATTTTTTTTTTAATAGAGACGGG + Intergenic
1182217650 22:28732416-28732438 TTTGTATTTTTAACAGAGACAGG + Intronic
1182403907 22:30107575-30107597 TTTGTATTTATAGCAGAGACAGG - Intronic
1183390747 22:37544568-37544590 ATTTTTTTTTTAATAGAGACAGG + Intergenic
1183847846 22:40557597-40557619 ATTTTTTTTAAAAAAGAGACAGG - Intronic
1183903650 22:41023789-41023811 ATTTGTTTTTTAGTAGAGACAGG + Intergenic
1184115768 22:42421277-42421299 TTTGTATTTTTAACAGAGACGGG - Intronic
1184397333 22:44250534-44250556 ATTGCTCTTATAATAGACACAGG - Intronic
1184718960 22:46298132-46298154 TTTGTATTTTTAACAGAGACGGG + Intronic
1185286920 22:50005628-50005650 ATTGTATTTTTAGCAGAGACGGG - Intronic
949807843 3:7974968-7974990 TTTTTTTTTTTAACAGAGACAGG - Intergenic
949927950 3:9057098-9057120 CGTTGTTTTTTAACAGAGACAGG + Intronic
949928278 3:9058889-9058911 TTTGTATTTTTAACAGAGACAGG + Intronic
950223938 3:11218271-11218293 TTTGTATTTTTAACAGAGACGGG - Intronic
950383218 3:12635152-12635174 TTTGTATTTTTAACAGAGACAGG - Intronic
950493564 3:13320458-13320480 TTTGTTTTTTTAATAGAGACAGG - Intronic
950513483 3:13447944-13447966 ATTTTTTTTTTAGCAGAGACAGG + Intergenic
950825621 3:15817022-15817044 TTTTGTTTTCTTACAGAGACAGG - Intronic
951014869 3:17719780-17719802 GTTGTTTATATAACACAGACTGG - Intronic
951452279 3:22852930-22852952 ATAGGTGTTTTAGCAGAGACAGG - Intergenic
951472466 3:23070995-23071017 AATGCTTTTATTGCAGAGACAGG - Intergenic
951879839 3:27469582-27469604 ATTGTATTTTTAATAGAGACAGG - Intronic
951892625 3:27581259-27581281 ATTGTATTTCTAATAGAGACGGG - Intergenic
952093544 3:29921233-29921255 TTTGTTTTTTTAATAGAGACAGG + Intronic
952428468 3:33199444-33199466 TTTGTATTTTTAACAGAGACAGG + Intronic
952789439 3:37187803-37187825 ATTAATTTTTTAATAGAGACTGG + Intergenic
953259122 3:41320743-41320765 TTTGTATTTATAGCAGAGACAGG - Intronic
953740753 3:45536945-45536967 ATTCTTTTTTTAACAGAGATAGG + Intronic
955844536 3:63147967-63147989 TTTGTATTTTTAACAGAGACAGG - Intergenic
956205330 3:66749304-66749326 TTTGTATTTTTAACAGAGACAGG - Intergenic
956446433 3:69330666-69330688 ATGTATTTTATAATAGAGACAGG + Intronic
956562358 3:70593999-70594021 TTTGTATTTTTAACAGAGACGGG - Intergenic
957645648 3:82921271-82921293 ATTGCTTTTATCAAAAAGACAGG - Intergenic
957665563 3:83220448-83220470 ATTAGCTTTATAACACAGCCTGG + Intergenic
958150287 3:89684419-89684441 ATTTTTTTTTTAATAGAGACGGG + Intergenic
958194995 3:90232756-90232778 ATTGTTTTTTTAAGATAGACAGG - Intergenic
959601793 3:108195295-108195317 AATGGTTTTATCAAAAAGACAGG + Intronic
960748722 3:120921144-120921166 ATGGCTTTTATAAAAGAGACAGG - Intronic
961169808 3:124789020-124789042 GTTTGTTTTACAATAGAGACAGG - Intronic
961292363 3:125857987-125858009 TTTGTATTTTTAACAGAGACGGG - Intergenic
961294275 3:125871793-125871815 TTTGGATTTTTAATAGAGACAGG - Intergenic
961321569 3:126080527-126080549 ATGGCTTTTATAAAAAAGACAGG + Intronic
961540511 3:127596248-127596270 TTTGGATTTTTAATAGAGACAGG + Intronic
961900538 3:130206427-130206449 ATTGTATTTTTAATAGAGACAGG - Intergenic
961958521 3:130829342-130829364 ATTTGTTTTCTAACAAAGAGCGG + Intergenic
962095907 3:132292521-132292543 TTTGTATTTTTAACAGAGACAGG + Intergenic
962785420 3:138763937-138763959 TTTGCATTTTTAACAGAGACGGG - Intronic
964106817 3:153048476-153048498 TTTGTATTTTTAACAGAGACGGG - Intergenic
964370324 3:155993674-155993696 ATTGGTTTTATGCCAGCGAGTGG + Intergenic
964767557 3:160193491-160193513 AGTGGTTTTAAAACAGAGCATGG + Intergenic
964895787 3:161593228-161593250 TTTTCTTTTATAATAGAGACAGG + Intergenic
965414303 3:168373234-168373256 TTTGTTTTTTTAATAGAGACAGG - Intergenic
966295457 3:178415808-178415830 TTTTGTTTTTTAATAGAGACAGG - Intergenic
966417940 3:179708484-179708506 ATTGTATTTTTAATAGAGACGGG + Intronic
966479708 3:180393148-180393170 ATTGTATTTTTAATAGAGACAGG - Intergenic
966557081 3:181274735-181274757 ATTGCTTTCATCACAGAAACTGG - Intergenic
966610323 3:181861619-181861641 ATTGTATTTTTAGCAGAGACAGG - Intergenic
966659772 3:182401383-182401405 TTTGTATTTTTAACAGAGACAGG - Intergenic
966936718 3:184715192-184715214 TTTGTATTTTTAACAGAGACGGG + Intergenic
967029591 3:185593279-185593301 TTTAGTTTTTTAATAGAGACAGG + Intronic
967074096 3:185986783-185986805 TTTGTATTTTTAACAGAGACGGG - Intergenic
967487370 3:190048822-190048844 AGAAGTTCTATAACAGAGACAGG + Intronic
967835949 3:193962864-193962886 ATTGCTTTTATAAAGGAGCCTGG + Intergenic
967871590 3:194234285-194234307 ATTGTATTTTTAATAGAGACGGG - Intergenic
969065507 4:4477026-4477048 ATTGTATTTTTAATAGAGACGGG - Intronic
969905231 4:10387523-10387545 ATTGTATTTCTAATAGAGACAGG - Intergenic
970060168 4:12024793-12024815 TTTTGTTTTTTAGCAGAGACAGG + Intergenic
970143103 4:13004188-13004210 CTTAGTTTTACAACAGAGAGTGG + Intergenic
970294537 4:14614410-14614432 TTTGTTTTTTTAACAGAGACGGG - Intergenic
970651349 4:18181888-18181910 ATGGCTTTTATAAAAAAGACAGG + Intergenic
971556853 4:28023414-28023436 TTTGGATTTTTAATAGAGACGGG + Intergenic
971730182 4:30369629-30369651 TTTTGTTTTTTAATAGAGACAGG + Intergenic
971769528 4:30878580-30878602 ATTTCTTTTATATCATAGACTGG - Intronic
971797722 4:31250333-31250355 ATGGCTTTTATAAAAAAGACAGG + Intergenic
971813086 4:31452951-31452973 ATTTTTATTATAATAGAGACAGG + Intergenic
971852589 4:32002353-32002375 ATTTGTTTTAGAACAGATAAAGG - Intergenic
971935657 4:33143935-33143957 ATTGCTTTTATTGCAGAGGCTGG + Intergenic
972132646 4:35857601-35857623 TTTTGTTTTTTAAAAGAGACGGG - Intergenic
972471154 4:39405773-39405795 ATTGTATTTTTAATAGAGACGGG + Intergenic
972621105 4:40749294-40749316 TTTTTTTTAATAACAGAGACAGG - Intergenic
972747091 4:41945797-41945819 TTTGTATTTTTAACAGAGACAGG - Intronic
972782229 4:42295936-42295958 ATTGTATTTTTAGCAGAGACGGG - Intergenic
972893809 4:43593851-43593873 TTTGTTTTTTTAGCAGAGACAGG - Intergenic
973195128 4:47430779-47430801 TTTTTTTTTTTAACAGAGACAGG - Intergenic
973686041 4:53370904-53370926 ATTTTTTTTTTTACAGAGACAGG + Intergenic
973711583 4:53634841-53634863 ATTATTTTTTTAAGAGAGACAGG + Intronic
973809498 4:54556381-54556403 ATTTTTTATAAAACAGAGACAGG - Intergenic
974190678 4:58498558-58498580 ATTGGTTCTATAACATACTCTGG - Intergenic
974497198 4:62647341-62647363 TTTGTATTTTTAACAGAGACGGG + Intergenic
974609305 4:64194989-64195011 TTTGTATTTTTAACAGAGACGGG + Intergenic
975081241 4:70283059-70283081 TTTATTTTTTTAACAGAGACAGG - Intergenic
975198517 4:71555861-71555883 TTTGGTTTTTTTAAAGAGACAGG - Intronic
975894354 4:79069528-79069550 ATGGTTTTTATAAAAAAGACAGG + Intergenic
975895393 4:79084090-79084112 ATTTGTACTATAATAGAGACAGG - Intergenic
976098310 4:81532977-81532999 TTTGTATTTTTAACAGAGACGGG + Intronic
976240801 4:82954587-82954609 TTTGTATTTTTAACAGAGACGGG + Intronic
976861222 4:89669372-89669394 ATGGCATTTATTACAGAGACAGG - Intergenic
977489516 4:97694633-97694655 ATTTTTTTTTTAATAGAGACGGG - Intronic
977825741 4:101529664-101529686 CTTGTATTTTTAACAGAGACGGG - Intronic
978180048 4:105782752-105782774 TTTGTATTTATAATAGAGACGGG + Intronic
978417094 4:108488195-108488217 ATTTTTTTTTTAGCAGAGACGGG + Intergenic
978534537 4:109747189-109747211 TTTCTTTTTAAAACAGAGACAGG + Intronic
979236871 4:118410247-118410269 ACTGGTTTTAAAACAGATTCTGG - Intergenic
979615523 4:122738381-122738403 TTTTGTATTTTAACAGAGACGGG + Intronic
979873044 4:125850652-125850674 ATTTTTTTTTTAATAGAGACAGG + Intergenic
980071828 4:128251942-128251964 ATTGTATTTTTAATAGAGACAGG - Intergenic
980247377 4:130265341-130265363 ATGGCTTTTATAAAAAAGACAGG - Intergenic
980309351 4:131105017-131105039 ATTGGTTTTATACTAGAGTATGG + Intergenic
980777940 4:137461157-137461179 ATTTTTTTTTTAATAGAGACAGG + Intergenic
981525913 4:145706985-145707007 TTTGGATTTTTAATAGAGACGGG + Intronic
981872563 4:149504608-149504630 AGTGCTTTTACAAAAGAGACTGG + Intergenic
982174650 4:152694305-152694327 TTTGTATTTTTAACAGAGACAGG - Intronic
982651439 4:158092493-158092515 TTTGTATTTTTAACAGAGACAGG + Intergenic
983024741 4:162721133-162721155 TCTGGTTTCAGAACAGAGACAGG + Intergenic
983111562 4:163756453-163756475 ATTTTTTTTTTAATAGAGACAGG - Intronic
983827028 4:172275783-172275805 TTTGTATTTATAATAGAGACGGG - Intronic
984261347 4:177446106-177446128 ATTTTTTTTTTAATAGAGACAGG - Intergenic
984433274 4:179676030-179676052 ATTGTTTTTTTAGTAGAGACGGG + Intergenic
984784618 4:183555982-183556004 ATTGATTTGATACAAGAGACGGG - Intergenic
984821232 4:183884464-183884486 CTTCCTTTTAAAACAGAGACAGG - Intronic
987276790 5:16371548-16371570 AGTGAATTTATAACAGAGACAGG - Intergenic
987381430 5:17289372-17289394 TTTGTATTTTTAACAGAGACGGG - Intergenic
987427221 5:17786981-17787003 ATTGGCTTAATAGCAGAGATAGG - Intergenic
987477502 5:18409585-18409607 ACTAGTTTTATAATTGAGACAGG + Intergenic
988588166 5:32525848-32525870 AAGGGTTTTAGACCAGAGACTGG - Intergenic
988966560 5:36424491-36424513 ATTGTATTTTTAATAGAGACAGG + Intergenic
989058691 5:37388879-37388901 ATTATTTTTTTAATAGAGACGGG - Intronic
989794636 5:45452222-45452244 ACTGGATGTAGAACAGAGACAGG + Intronic
990530927 5:56672848-56672870 AGTGGTTATAAAACACAGACAGG - Intergenic
990592030 5:57275874-57275896 TTTGTATTTTTAACAGAGACAGG + Intergenic
991513066 5:67401347-67401369 ATTTGTTTTTCATCAGAGACAGG - Intergenic
991684706 5:69170953-69170975 TTTTCTTTTTTAACAGAGACAGG + Intronic
991914472 5:71592207-71592229 ATTGTATTTTTAATAGAGACCGG - Intronic
992799018 5:80279244-80279266 ATTGTATTTTTAGCAGAGACGGG - Intergenic
992903667 5:81324110-81324132 TTTTGTTTTTTAATAGAGACGGG + Intergenic
993114614 5:83705216-83705238 TTTGTATTTTTAACAGAGACAGG - Intronic
993300247 5:86200017-86200039 TTTGCATTTTTAACAGAGACAGG - Intergenic
993393468 5:87352699-87352721 ACTGGTTTTATATCAGAAACAGG - Intronic
993583387 5:89692262-89692284 ATTGTATTTTTAGCAGAGACAGG + Intergenic
995286525 5:110395209-110395231 CTTTGTTTTATAGAAGAGACAGG + Intronic
995505026 5:112851367-112851389 ATTATTTTTAAAATAGAGACAGG - Intronic
995516513 5:112959760-112959782 TTTGTTTTTTTAATAGAGACGGG + Intergenic
995741640 5:115362177-115362199 AATGTTTTTAGGACAGAGACAGG - Intergenic
996223903 5:120965872-120965894 TTTTTTTTTTTAACAGAGACTGG - Intergenic
997151931 5:131506307-131506329 ATTTATTTTTTAATAGAGACAGG + Intronic
997991250 5:138545929-138545951 ATTTTTTTTTTAGCAGAGACAGG + Intergenic
998047024 5:138996197-138996219 ATGGCTTTTATCAAAGAGACAGG - Intronic
999057173 5:148590465-148590487 TTTGGATTTTTAATAGAGACGGG + Intronic
999129670 5:149272872-149272894 TTTGTATTTTTAACAGAGACGGG + Intronic
999290361 5:150421448-150421470 TTTGTGTTTATAATAGAGACAGG + Intergenic
999534383 5:152501319-152501341 TTTGGTTTTTAAATAGAGACAGG - Intergenic
999747245 5:154601632-154601654 TTTGGATTTTTAATAGAGACAGG + Intergenic
999841861 5:155436416-155436438 AGTGCTTTTATAAAAGAGACTGG + Intergenic
1000119255 5:158180882-158180904 ATCACTTTTATAACAGAGATGGG + Intergenic
1000515383 5:162232251-162232273 TTTTGTTTTAGAAAAGAGACTGG + Intergenic
1000699817 5:164434815-164434837 TTTGTATTTTTAACAGAGACGGG + Intergenic
1000797691 5:165685614-165685636 TTTGTTTTTTTAGCAGAGACAGG + Intergenic
1000890785 5:166799346-166799368 TTTGTTTTTATAGTAGAGACAGG - Intergenic
1001021847 5:168189777-168189799 ATTGTATTTCTAATAGAGACAGG + Intronic
1001023475 5:168204021-168204043 ATTATTTTTTTAATAGAGACAGG + Intronic
1001752108 5:174139401-174139423 TTTTTTTTTTTAACAGAGACAGG + Intronic
1002057288 5:176605802-176605824 ACTGTCTTTAAAACAGAGACAGG + Intronic
1002354206 5:178610743-178610765 ATGTTTTTTATAACAGAGACAGG - Intronic
1002404249 5:179016989-179017011 ATAGATTCTAAAACAGAGACAGG - Intergenic
1002760362 6:197128-197150 TTTGTATTTTTAACAGAGACGGG + Intergenic
1002812724 6:648899-648921 ATTTTTTTTTTAATAGAGACAGG + Intronic
1002840355 6:900043-900065 TTTGTATTTTTAACAGAGACAGG + Intergenic
1003615193 6:7648856-7648878 TTTGTATTTTTAACAGAGACGGG + Intergenic
1003752864 6:9080982-9081004 TTTGCATTTATAACAGAGACTGG + Intergenic
1003759023 6:9153741-9153763 TTTGTATTTTTAACAGAGACAGG - Intergenic
1004650621 6:17603992-17604014 TTTGGTTTTATATCAGAGACTGG - Intronic
1004725780 6:18309896-18309918 ATTTATTTTTTAATAGAGACAGG - Intergenic
1005579109 6:27216874-27216896 TTTGTATTTTTAACAGAGACAGG - Intergenic
1005587073 6:27287199-27287221 TTTGTATTTCTAACAGAGACAGG - Intronic
1005631662 6:27713829-27713851 TTTGTATTTTTAACAGAGACAGG - Intergenic
1005697173 6:28362379-28362401 ATTGTTTTAATAACAGACCCAGG - Intronic
1006179564 6:32146583-32146605 AATGGTCTATTAACAGAGACAGG + Intergenic
1006464770 6:34186340-34186362 ATTGTGTTTTTAGCAGAGACAGG - Intergenic
1007456280 6:41979805-41979827 TTTTGTTTTTTAATAGAGACTGG + Intronic
1007545881 6:42694197-42694219 TTTGGTTTTTTTAAAGAGACAGG + Intergenic
1007682783 6:43645660-43645682 GATGGGTTTATAAGAGAGACAGG + Intronic
1008005271 6:46403399-46403421 TTTGTTTTTTTAGCAGAGACAGG - Intronic
1008754889 6:54782692-54782714 GTTGTTTTTTTAATAGAGACAGG - Intergenic
1008905485 6:56673081-56673103 ATTTTTTTTTTAATAGAGACAGG - Intronic
1009441243 6:63681440-63681462 ATTTGTTACATAACAGGGACTGG + Intronic
1010241642 6:73621308-73621330 TTTGTATTTTTAACAGAGACAGG + Intronic
1010602289 6:77844688-77844710 GTTGTATTTATAACAGTGACTGG + Intronic
1011171247 6:84506273-84506295 ATTTTTTTTTTAGCAGAGACAGG + Intergenic
1011592802 6:88986628-88986650 TTTTGTTTTTTAATAGAGACAGG - Intergenic
1011607484 6:89118489-89118511 TTTGTTTTTTTAATAGAGACGGG + Intergenic
1012194248 6:96318801-96318823 TTATGTTTTATAAAAGAGACTGG - Intergenic
1012502776 6:99907979-99908001 ATGGCTTTAATAAAAGAGACAGG + Intergenic
1013295403 6:108754115-108754137 ATTGTTTTTATGGTAGAGACGGG + Intergenic
1013326604 6:109051233-109051255 ATTGGTTTTATAAAACAGCAGGG + Intronic
1014023837 6:116621028-116621050 TTTGTTTTTTTAATAGAGACGGG + Intronic
1014109957 6:117609435-117609457 ATTGTATTTTTAGCAGAGACAGG + Intergenic
1014334389 6:120114636-120114658 ATTGGGTTTATAACACATATAGG - Intergenic
1015154684 6:130079619-130079641 ATTGCCTTTATTACAGAGAGAGG + Intronic
1015529030 6:134202470-134202492 ATTGTATTTTTAATAGAGACAGG - Intronic
1015918168 6:138239474-138239496 TTTGGATTTTTAATAGAGACGGG - Intronic
1016104127 6:140140643-140140665 ATTTTTTTTTTAATAGAGACGGG - Intergenic
1016215102 6:141590190-141590212 TTTGTTTTTTTAATAGAGACGGG + Intergenic
1016818616 6:148326571-148326593 ATTGTATTTTTAATAGAGACGGG + Intronic
1019740852 7:2672327-2672349 TTTTGTTTTTTAGCAGAGACAGG - Intergenic
1019885541 7:3901357-3901379 TTTGTTTTTTTAATAGAGACGGG + Intronic
1020945798 7:14604247-14604269 ATTGTTTTTAAAACAGAAATGGG - Intronic
1021053591 7:16019735-16019757 AGTGGTTGTATATCAGAAACAGG - Intergenic
1021184703 7:17550321-17550343 ATTTGTTTTATTACAGAAAAAGG - Intergenic
1021495399 7:21268916-21268938 TTTGGATTTTTAATAGAGACGGG + Intergenic
1021699522 7:23303932-23303954 ATTGTATTTTTAATAGAGACAGG - Intronic
1021702046 7:23329034-23329056 ATTTCTTTTTTAGCAGAGACGGG - Intronic
1022002878 7:26242784-26242806 TTTTGTATTTTAACAGAGACAGG - Intergenic
1022159223 7:27692202-27692224 ATTGGTTTGACAGGAGAGACTGG + Intergenic
1022159606 7:27696170-27696192 TTTGGCTTTTTAAAAGAGACAGG + Intergenic
1022167566 7:27784812-27784834 ATTTTTTTTTTAATAGAGACAGG - Intronic
1022982848 7:35620704-35620726 TTTGTATTTATAATAGAGACGGG - Intergenic
1022990804 7:35705360-35705382 TTTGGATTTTTAATAGAGACGGG + Intergenic
1023394837 7:39743148-39743170 ATTGGATTTATACTAGAGATGGG + Intergenic
1023445203 7:40224021-40224043 ATTGGTTTTATGTGAGAGTCTGG + Intronic
1023507296 7:40913311-40913333 ATTGATTTTATAACACATCCTGG + Intergenic
1023787847 7:43725684-43725706 TTTTGTTTTATAGTAGAGACGGG - Intronic
1024335395 7:48201546-48201568 TTTGGATTTATAGTAGAGACAGG - Intronic
1024666124 7:51548879-51548901 ATTGTATTTATAGTAGAGACAGG - Intergenic
1025007915 7:55368971-55368993 ATTCTTTTTAAAAAAGAGACAGG - Intronic
1025185380 7:56853855-56853877 ATTTTTTTTATCATAGAGACGGG - Intergenic
1025288986 7:57695650-57695672 TTTGGTTTTTTATTAGAGACGGG + Intergenic
1025899654 7:65733352-65733374 TTTAGTTTTATAATAAAGACAGG - Intergenic
1025937123 7:66046353-66046375 TTTGTTTTTTTAGCAGAGACGGG - Intergenic
1026260006 7:68747004-68747026 TTTGAATTTTTAACAGAGACAGG + Intergenic
1026281588 7:68927272-68927294 ATTGTGTTTTTAGCAGAGACGGG + Intergenic
1026475016 7:70727741-70727763 CTTGGTTTTATAAGACAGGCTGG + Intronic
1026535568 7:71236007-71236029 TTTGTGTTTTTAACAGAGACAGG - Intronic
1026924487 7:74180908-74180930 ATTGTTTTTTTAATAGAGACAGG + Intronic
1026945010 7:74310215-74310237 TTTTATTTTAGAACAGAGACAGG - Intronic
1026999393 7:74641634-74641656 TTTGTATTTTTAACAGAGACGGG - Intergenic
1027406358 7:77865523-77865545 ATTGATATTATAAAAGAGATTGG - Intronic
1027586120 7:80061150-80061172 TTTGTATTTATAGCAGAGACGGG + Intergenic
1028636328 7:92993731-92993753 ATTGGTGTTGAAACAGAGCCTGG + Intergenic
1028777867 7:94701012-94701034 ATTTTTTTTTTAATAGAGACAGG - Intergenic
1029390963 7:100273831-100273853 AATTTTTTTATAGCAGAGACAGG + Intergenic
1029453198 7:100654289-100654311 ATTGTTTTAATAAAAGAGACGGG + Intronic
1029682955 7:102124951-102124973 TTTGTATTTTTAACAGAGACAGG + Intronic
1029814818 7:103082505-103082527 ATTTTTTTTTTAATAGAGACAGG + Intronic
1030064043 7:105645621-105645643 TTTGGATTTTTAGCAGAGACAGG - Intronic
1030352558 7:108506204-108506226 TTTGGTTTTTTAGTAGAGACGGG - Intronic
1032269505 7:130390923-130390945 ATTGTTTTTTTTATAGAGACTGG - Intergenic
1032347023 7:131125829-131125851 TTTGTATTTTTAACAGAGACGGG - Intronic
1032370949 7:131351240-131351262 TTTGTTTTTTTAAAAGAGACAGG - Intronic
1032531136 7:132621430-132621452 TTTGTATTTTTAACAGAGACGGG + Intronic
1032717860 7:134526353-134526375 TTTGGATTTTTAGCAGAGACAGG + Intergenic
1032815815 7:135472866-135472888 TTTGGTTTTTTTATAGAGACAGG - Intronic
1033198154 7:139344884-139344906 TTTGGATTTTTAGCAGAGACAGG + Intronic
1033366402 7:140675313-140675335 ATTATTTTAAAAACAGAGACAGG + Intronic
1033417041 7:141171279-141171301 TTTGGTTTTTTTCCAGAGACAGG - Intronic
1033496488 7:141902210-141902232 ATTGGTCTTATCAGAGAGAAAGG - Intergenic
1033854545 7:145543160-145543182 ATTGATTTTATAACTGGCACTGG - Intergenic
1034133211 7:148740224-148740246 TTTGTATTTTTAACAGAGACAGG + Intronic
1034512065 7:151543763-151543785 TTTTCTTTTTTAACAGAGACAGG + Intergenic
1034536808 7:151730492-151730514 ATTTGTTTTTAAAAAGAGACGGG - Intronic
1034912009 7:155004278-155004300 ATTGGTTTTAAAAAAGAGAAGGG + Intergenic
1035985656 8:4428884-4428906 TTTGCATTTTTAACAGAGACAGG + Intronic
1036247758 8:7134151-7134173 ATTGTATTTTTAATAGAGACAGG + Intergenic
1036361962 8:8084230-8084252 TTTGTATTTTTAACAGAGACAGG - Intergenic
1036732316 8:11276708-11276730 TTTGGTATTTTAATAGAGACAGG - Intergenic
1036774763 8:11603389-11603411 ATTTTTTTTTTAATAGAGACAGG - Intergenic
1037052540 8:14394320-14394342 TTTGTGTTTCTAACAGAGACTGG + Intronic
1037109297 8:15146758-15146780 AATATTTTTATAAAAGAGACTGG + Intronic
1037303487 8:17479807-17479829 TTTGGGTTTTTAGCAGAGACGGG + Intergenic
1037488855 8:19377208-19377230 TTTGGATTTTTAATAGAGACGGG - Intronic
1037708655 8:21337758-21337780 TTTGTATTTTTAACAGAGACAGG - Intergenic
1037798750 8:22019257-22019279 TTTGGATTTTTAGCAGAGACGGG - Intergenic
1037945736 8:22988331-22988353 TTTGTTTTTTTAATAGAGACAGG + Intronic
1039054991 8:33528857-33528879 ATTGTTTTAAAAACAGAGACGGG - Intergenic
1040073768 8:43209190-43209212 AATAGTTTTATTTCAGAGACTGG + Intergenic
1040844149 8:51818678-51818700 ATTTGTTTTATACCAGTGGCTGG - Exonic
1040861616 8:52005306-52005328 ATTGGTATTATTATAGGGACGGG + Intergenic
1041063627 8:54060294-54060316 TTTGTATTTATAATAGAGACGGG + Intronic
1041071873 8:54133370-54133392 GTTGGTTTTTTAGTAGAGACTGG - Intergenic
1041187936 8:55321250-55321272 TTTAGTTTAATAACAGAGAGAGG - Intronic
1042219464 8:66459436-66459458 TTTTTTTTTTTAACAGAGACAGG + Intronic
1042241890 8:66672523-66672545 TTTGTATTTTTAACAGAGACAGG - Intronic
1042669343 8:71244532-71244554 ATTGGTTTTAAAATAAAGATAGG - Intronic
1043709723 8:83401402-83401424 ATTGGTTTGACAACAAGGACTGG + Intergenic
1043939473 8:86180668-86180690 TTTGTTTTTTTAATAGAGACAGG + Intergenic
1044284995 8:90400630-90400652 TTTGGGTTTTTAATAGAGACGGG + Intergenic
1044444358 8:92257192-92257214 TTTGTGTTTCTAACAGAGACAGG - Intergenic
1044542327 8:93421826-93421848 CTTTGTTTTTTAATAGAGACAGG + Intergenic
1044658253 8:94570758-94570780 ATTATTTTTTTAATAGAGACAGG - Intergenic
1046214308 8:111123104-111123126 TTTTGTTTTTTAATAGAGACGGG + Intergenic
1046729210 8:117707275-117707297 AGTGCTTTTATAAAAGAGACTGG - Intergenic
1046945315 8:119968920-119968942 TTTGTTTTTATAGTAGAGACGGG - Intronic
1046946691 8:119980687-119980709 TTTGTATTTTTAACAGAGACAGG + Intronic
1047142193 8:122153786-122153808 TTTGGATTTTTAGCAGAGACAGG - Intergenic
1047349254 8:124057763-124057785 ATAGGTTTTAAAAAAGAGGCAGG - Intronic
1047879579 8:129178872-129178894 TTTGTATTTTTAACAGAGACGGG + Intergenic
1048709739 8:137195834-137195856 TTTGTATTTTTAACAGAGACGGG + Intergenic
1048826585 8:138433348-138433370 TTTGTTTTTTTAATAGAGACGGG - Intronic
1049188764 8:141274360-141274382 TTTGTATTTTTAACAGAGACTGG - Intronic
1049870127 8:144968349-144968371 TTTCATTTTTTAACAGAGACAGG - Intergenic
1050568838 9:6916444-6916466 ATTTGTTTTTTTATAGAGACAGG + Intronic
1051341589 9:16116719-16116741 ATTGTTTTTTTAGTAGAGACAGG - Intergenic
1052281695 9:26740698-26740720 TTTTTTTTTTTAACAGAGACTGG - Intergenic
1052930355 9:34050687-34050709 TTTGTATTTTTAACAGAGACGGG - Intergenic
1054854510 9:69884277-69884299 ATTGTTTTTATTTTAGAGACAGG + Intronic
1055563885 9:77549104-77549126 TTTGGATTTTTAGCAGAGACAGG + Intronic
1055926088 9:81511331-81511353 ATTTTTTTTTTAATAGAGACAGG + Intergenic
1056021088 9:82439221-82439243 AGTGGATTTATAACTGAGATGGG + Intergenic
1056408903 9:86305123-86305145 TTTACTTTTATAATAGAGACAGG - Intronic
1056639270 9:88356805-88356827 TTATGTTTTAGAACAGAGACTGG + Intergenic
1057027773 9:91748088-91748110 GTTGGTTTTTTAGTAGAGACAGG - Intronic
1057343837 9:94229642-94229664 TTTGTATTTGTAACAGAGACGGG + Intergenic
1058691346 9:107523165-107523187 ATGCGTTTTTTAATAGAGACAGG - Intergenic
1059185850 9:112270116-112270138 TTTGGGTTTATAGTAGAGACAGG + Intronic
1059200688 9:112412929-112412951 ATTTTTTTTAAAACAGAGACAGG - Intronic
1059478226 9:114566525-114566547 TTTGTATTTTTAACAGAGACGGG - Intergenic
1059759545 9:117325079-117325101 AGTGGGTTGATAACAGAGAGTGG + Intronic
1061823797 9:133244919-133244941 TTTGTATTTATAATAGAGACGGG + Intergenic
1062637159 9:137497697-137497719 TTTGTATTTTTAACAGAGACAGG + Intronic
1203532761 Un_GL000213v1:163411-163433 AGGGGTTTTATAATAAAGACAGG + Intergenic
1185660626 X:1726051-1726073 ATTTATTTTTTAACAGTGACGGG + Intergenic
1185979896 X:4766881-4766903 ATTTTTTTTTTAAGAGAGACGGG + Intergenic
1186241956 X:7578066-7578088 ATTTTTTTTTAAACAGAGACAGG - Intergenic
1186359327 X:8823137-8823159 TTTGGATTTTTAGCAGAGACAGG + Intergenic
1186385764 X:9108875-9108897 TTTTATTTTATGACAGAGACTGG + Intronic
1186630722 X:11345885-11345907 ATTGGTTCTATTAGAGAGAAAGG - Intronic
1187918002 X:24173900-24173922 CTTGGTTTTATAACATAAAAGGG + Intronic
1188599535 X:31944679-31944701 TTTGTATTTTTAACAGAGACAGG + Intronic
1189266414 X:39720202-39720224 ATTGTATTTTTAGCAGAGACAGG + Intergenic
1190106124 X:47562212-47562234 CCTGGTTTTTTAACAGAGAACGG - Intronic
1190859718 X:54332713-54332735 TTTGGTTTTTTAGTAGAGACAGG - Intronic
1191638451 X:63403440-63403462 TTTGTATTTATAATAGAGACAGG + Intergenic
1193099429 X:77592238-77592260 TTTGTTTTTTTAATAGAGACGGG - Intronic
1193379640 X:80803609-80803631 ATAGGTATTATGACAGAGAGAGG - Intronic
1193736636 X:85164893-85164915 TTTGTATTTTTAACAGAGACGGG + Intergenic
1193837313 X:86359740-86359762 TTTGTTTTTTTAACTGAGACAGG - Intronic
1194410965 X:93556964-93556986 ATTGGGTTTATTAAAAAGACTGG - Intergenic
1195034530 X:100960308-100960330 ATTTATTTTTTAATAGAGACAGG - Intergenic
1195623616 X:106984643-106984665 ATTTTTTTTTTAATAGAGACGGG + Intronic
1196825986 X:119740583-119740605 ATTGTTTTTCTAATAGAGATGGG - Intergenic
1197086927 X:122489382-122489404 AGTGGTTTTCTAACAGAAGCTGG - Intergenic
1197503179 X:127266639-127266661 ATTGTTTTTTTAGTAGAGACGGG - Intergenic
1197533146 X:127655417-127655439 ATTGGCTTTACAACAGTGACAGG + Intergenic
1197798801 X:130327910-130327932 TTTGTATTTTTAACAGAGACAGG - Intergenic
1198209196 X:134500708-134500730 ATAGGTTTTTTTAAAGAGACAGG - Intronic
1198255131 X:134917782-134917804 ATTTTTTTTTTAATAGAGACAGG + Intergenic
1199004735 X:142682382-142682404 TTTGTGTTTTTAACAGAGACGGG + Intergenic
1199135699 X:144249085-144249107 ATTGGTTTTATTTAAAAGACAGG + Intergenic
1200185632 X:154181428-154181450 ATTTTTTTTTTAATAGAGACGGG - Intergenic
1200202691 X:154293489-154293511 ATTTTTTTTTTAATAGAGACGGG - Intronic
1200500440 Y:3941674-3941696 TTTGGATTTATAGTAGAGACGGG + Intergenic
1200738938 Y:6832102-6832124 ATTGGTTCTATTAGAGAGAAAGG + Intergenic
1200755524 Y:6986519-6986541 TTTGGTTTTGTTTCAGAGACAGG - Intronic