ID: 1173826538

View in Genome Browser
Species Human (GRCh38)
Location 20:46051421-46051443
Sequence CTGTATGAGCAGTGGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173826538 Original CRISPR CTGTATGAGCAGTGGGAGGG TGG Intronic
900457924 1:2786325-2786347 CTGTCTGAGCACTAGGAGGTTGG + Intronic
902481030 1:16711969-16711991 TGGTCTGTGCAGTGGGAGGGAGG - Intergenic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903568244 1:24285058-24285080 CTGCATGAGGAGCGGGATGGAGG - Intergenic
904209832 1:28879667-28879689 GTGGATGAGCAGGGGGAGGTGGG + Intergenic
904629427 1:31829976-31829998 CTTTATGAGCTGTGGGAAGGAGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905178231 1:36151156-36151178 CTGAATGAACAGTGGGGGTGGGG + Intronic
907627072 1:56040626-56040648 ATGCATGAGCTGTGGGAGTGTGG - Intergenic
907814262 1:57902878-57902900 CTTTATTAGCAGTGTGAGAGTGG - Intronic
908003727 1:59707391-59707413 CTGTAGGAGGAGGGGGAGAGAGG + Intronic
908430360 1:64050687-64050709 CTGGACTTGCAGTGGGAGGGGGG - Exonic
908474586 1:64474911-64474933 CTGGATGAGGCCTGGGAGGGAGG + Intronic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
914375862 1:147073055-147073077 CTGTATTAGGATTGGGAGGGAGG + Intergenic
915932594 1:160069604-160069626 CTGTATGGGGAGTGGGGGAGGGG + Intronic
916288052 1:163132511-163132533 CTATTTGAGCTGTGGGAAGGGGG + Intronic
916676305 1:167066713-167066735 CTGGAGGAGCAGTGATAGGGAGG + Intronic
916683663 1:167126179-167126201 CTGTACGAGCAGTGGAAGAAGGG + Exonic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921487657 1:215733954-215733976 CTGTTGGAGCTGTGGGAAGGGGG - Intronic
922471148 1:225878115-225878137 TTCTGTGAGCAGTGGGAGTGAGG - Intronic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
924042195 1:239994894-239994916 ATGTATGATTAGTGGTAGGGAGG + Intergenic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064704850 10:18061017-18061039 CTGTAAGAGTAGTGGGGAGGAGG + Intergenic
1068585810 10:58796923-58796945 CTGTATGAGGGGTGGGGAGGGGG + Intronic
1069034687 10:63634059-63634081 CTGGATGTGGAGTGTGAGGGAGG - Intergenic
1069991662 10:72320018-72320040 CTGTCAGAGCAGTGAGGGGGTGG - Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1071945252 10:90636613-90636635 TTGTCTGTGAAGTGGGAGGGAGG - Intergenic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073462114 10:103671755-103671777 GTGAAGGAGCAGTGGGGGGGAGG + Intronic
1073946824 10:108760468-108760490 CTGTAGGAGCTGTGAGTGGGAGG - Intergenic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1074539487 10:114352802-114352824 CTGTCGGAGCAGTGGAAAGGGGG - Intronic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1075020505 10:118948718-118948740 CTGGATTTGCAGAGGGAGGGAGG - Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076737514 10:132465411-132465433 CTGTGTAAGCACGGGGAGGGTGG - Intergenic
1077202699 11:1319517-1319539 CTGAAAGAGCAGGGTGAGGGGGG - Intergenic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077500565 11:2908144-2908166 CTGGATGGGCAGGGGGTGGGAGG - Intronic
1078835015 11:15018590-15018612 CTTTATTAGCAGTGTGAGAGTGG + Intronic
1079145922 11:17851856-17851878 CTGTGTAAGCAGTGGGGGTGGGG - Intronic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1080099635 11:28444953-28444975 CTGTATGAGGACTGGGACCGAGG + Intergenic
1080283329 11:30584105-30584127 GTGTAAGTGCGGTGGGAGGGAGG - Intronic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1084084975 11:66850834-66850856 GTGGATGTGCAGTGGGAGGTCGG + Exonic
1086059215 11:82683033-82683055 CTGTATGGGAAGTGGGGGGTGGG + Intergenic
1088812921 11:113403577-113403599 CTGGATCAGCACTGGGAGGATGG + Intergenic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090645629 11:128764842-128764864 CTCCCTGAGCAGTGGGAGGAGGG + Intronic
1090661649 11:128886514-128886536 CTCTTTGAGCAGGTGGAGGGTGG + Intergenic
1090762494 11:129849588-129849610 CTGTATGAGCTGTGGGAGCACGG - Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1091395053 12:149306-149328 TTGCATGTGCAGTGGGAGGAAGG + Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091628418 12:2140105-2140127 CCGTATGGGCAGTGAGAGAGGGG - Intronic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096673655 12:53214859-53214881 CTGCAGGAGCTGGGGGAGGGGGG + Intronic
1097402748 12:59149574-59149596 CTGTATGATAAGTGGTAGGTTGG - Intergenic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1098394714 12:70005711-70005733 TTGTAGGAGCAGTGGAAAGGTGG - Intergenic
1099929207 12:89053853-89053875 CTTTATTAGCAGTGTGAGTGCGG - Intergenic
1100631671 12:96395808-96395830 CTGCAGGTGAAGTGGGAGGGAGG - Intronic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104775378 12:131387540-131387562 CTCTTAGAGCAGTGGGAGTGGGG - Intergenic
1106546000 13:30731707-30731729 CTTTCTGGGCAATGGGAGGGGGG + Intronic
1107927895 13:45281177-45281199 CTGTATAAGGTGTGGGAGGTAGG + Intronic
1108453281 13:50588140-50588162 CTGTGTGGGCAGTGCGTGGGAGG + Intronic
1111586690 13:90291392-90291414 CTGTGTGAACAGTGGAACGGGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113789242 13:113018843-113018865 CCGCCTGGGCAGTGGGAGGGGGG - Intronic
1113823352 13:113231434-113231456 CTGTGTGGGGAGTGGGAGGTGGG + Intronic
1114871740 14:26666720-26666742 CTTTATCAGCAGTGTGAGAGTGG - Intergenic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119118671 14:72052378-72052400 CATTATGAAAAGTGGGAGGGGGG - Intronic
1119412616 14:74443403-74443425 GTGGATGAGGAGTGGCAGGGTGG + Intergenic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1121334588 14:93069584-93069606 CTGTCTGAGCTGTGGGGGAGTGG - Intronic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1125061844 15:35435472-35435494 CTGCATGAGCACTGGGAGAATGG + Intronic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1125485676 15:40109149-40109171 CTGTATTAGGTGTGGGAGAGGGG + Intergenic
1127914552 15:63444700-63444722 CTGTGTGTGCAGGGAGAGGGTGG + Intergenic
1127980154 15:64029136-64029158 CTGTAAGAGCTGGGGGCGGGGGG - Intronic
1129916695 15:79280373-79280395 CTTTATTAGCAGTGTGAGAGAGG + Intergenic
1132711587 16:1271299-1271321 CTCTATGAGCGGGGGGGGGGGGG + Intergenic
1132888573 16:2193564-2193586 CTGCCTCAGCTGTGGGAGGGAGG - Intronic
1133274199 16:4626779-4626801 ATGGATGCTCAGTGGGAGGGAGG - Intronic
1133768121 16:8851834-8851856 CTGTTGGGGCAGTGGGAGTGAGG - Intergenic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135673169 16:24392029-24392051 GTGTATGAGATGTGGGAGGCAGG + Intergenic
1136519441 16:30786666-30786688 CTGTATCAGCAGCGGGACGGGGG - Intronic
1138830592 16:60369778-60369800 CTATATGAGCAGTGTGAGAATGG + Intergenic
1139337367 16:66242167-66242189 CAGTATGAGGTGTGGGAGGGTGG + Intergenic
1140163386 16:72523173-72523195 CTGTATGTACAGTGTGAGAGAGG - Intergenic
1140851872 16:78942509-78942531 CTCTCTGGGCAGTGGGATGGGGG + Intronic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141201606 16:81902716-81902738 CTTTATGAGCAGTGTGAGAATGG - Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1143631514 17:8142885-8142907 CAGTAAGAGCAGTTGAAGGGAGG - Intronic
1143720556 17:8806123-8806145 CTGCATGAGCTGGGGGAGGGTGG + Intronic
1144018135 17:11216412-11216434 CTGTCTGAGAAATGGGAGGATGG - Intergenic
1144311232 17:14016054-14016076 TTGTATGTGCAATGGGAGGTAGG - Intergenic
1145962003 17:28892275-28892297 CTCAATGTGCAGTGGGAAGGTGG + Intronic
1146658178 17:34647653-34647675 CTGACTGAGGAGTGGGAGTGGGG - Intergenic
1148751668 17:49948890-49948912 CTGAGGGAGGAGTGGGAGGGAGG + Intergenic
1149017138 17:51921156-51921178 CTGTATGAGCAGTGGTTAGATGG - Intronic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152241595 17:79164029-79164051 CTGTCTGAGCTGTGGGGTGGAGG - Intronic
1154462653 18:14609904-14609926 CTGCATTTGGAGTGGGAGGGGGG + Intergenic
1155114966 18:22754927-22754949 CTGTAAGGGCAATGGGAGGTGGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157317341 18:46603339-46603361 GTGAATGTGCAGTGGGAGAGAGG + Intronic
1157442062 18:47719016-47719038 GTGGATGAGGAGTGGTAGGGGGG - Intergenic
1159692371 18:71504844-71504866 CTTTATTAGCAGTGAGAGAGTGG + Intergenic
1159721810 18:71899766-71899788 GGCTATGAGCAGTGGGAGTGGGG + Intergenic
1160436923 18:78858934-78858956 TGGTACCAGCAGTGGGAGGGAGG + Intergenic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161221502 19:3120172-3120194 CTGGATGTGCAGCGAGAGGGAGG + Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163758102 19:19118944-19118966 CAGTTTGAGGAATGGGAGGGCGG - Intergenic
1163884105 19:19950789-19950811 ATGTTTGAGAGGTGGGAGGGAGG - Intergenic
1164574680 19:29398829-29398851 CTGTCTGGGCAGTGGGATTGGGG - Intergenic
1164794816 19:31017338-31017360 CTGTATTAGCAGTGTGAGAATGG - Intergenic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926663982 2:15499604-15499626 GTCTATGAGCAGGTGGAGGGTGG + Intronic
927863572 2:26575324-26575346 GAGTATGAGAAGTGGGTGGGGGG - Intronic
928167425 2:28981355-28981377 CTGTCTGAGCAGGGGCTGGGTGG - Exonic
928273104 2:29874842-29874864 CTTGATGAGCAGGGGGAAGGTGG - Intronic
930192992 2:48479317-48479339 CTCCCTGAGCTGTGGGAGGGAGG + Intronic
930203397 2:48565346-48565368 CTGTATAAGAAGTCGGAGGCTGG - Intronic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932312589 2:70755701-70755723 TTTTATGAGGAGAGGGAGGGAGG - Intronic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935956856 2:108385562-108385584 CTCTAGGAGCAGAGGGCGGGTGG - Intronic
937923531 2:127149703-127149725 ATGTATGCGCAGTGGGATAGAGG - Intergenic
937932485 2:127218106-127218128 CTGTCTGAGCAGTGGGCAGGAGG + Intronic
938248395 2:129796233-129796255 CTGGAACAGCATTGGGAGGGTGG - Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943787121 2:191889943-191889965 CTTTATGAGCAGTGTGAGAATGG - Intergenic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946082710 2:217137833-217137855 GACTATGAGAAGTGGGAGGGAGG - Intergenic
947277323 2:228407124-228407146 CTGTATTAGCAGTGTGAGAAAGG + Intergenic
947546124 2:231011607-231011629 CTTCATGGCCAGTGGGAGGGTGG - Intronic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
1169293880 20:4376016-4376038 CTGTCTCAGCTGTGGGTGGGTGG + Intergenic
1169415428 20:5412082-5412104 CTGTCTGGGAAGTGGGAGTGGGG - Intergenic
1173464278 20:43268705-43268727 CTGTATTAGAAATGGGTGGGGGG + Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173875801 20:46370652-46370674 CTGTATGAGCTCAGTGAGGGTGG + Intronic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174544132 20:51312587-51312609 CTGCCTGAGCACTGGGAGGATGG - Intergenic
1174719551 20:52797375-52797397 CTCTATGAAGAGTGGGAAGGAGG + Intergenic
1176139394 20:63538353-63538375 CAGTAGGGTCAGTGGGAGGGTGG - Intergenic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1179032878 21:37735640-37735662 GTGTATGGGCTGTGGGAGGAAGG + Intronic
1179107039 21:38410550-38410572 CTGTATGTGGAGTGGGAGTGGGG + Intronic
1179107045 21:38410571-38410593 GGGTATAAGCAGTGGGAGGGAGG + Intronic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1180102392 21:45594938-45594960 CTGGATGAGCAGTGGAGTGGAGG - Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181522529 22:23457800-23457822 CTGTAGGAGCCGTGAGTGGGCGG + Intergenic
1181787616 22:25238322-25238344 GTGCATGAGAACTGGGAGGGAGG + Intergenic
1182747114 22:32614537-32614559 CTGTCTGACCAGTGGTGGGGAGG + Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
949777224 3:7646722-7646744 ATGTATGAGAAGTTGGAGGATGG + Intronic
950851851 3:16069747-16069769 CTCTAGGGGCAGTGGGAGGGTGG + Intergenic
952512497 3:34071255-34071277 CTGTATGAGGAGAGCCAGGGTGG + Intergenic
954129451 3:48552701-48552723 CTGAAGGAGCAGTTGGGGGGTGG - Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
956004307 3:64762235-64762257 ATGTAGGAGCAGGGGGAGTGGGG + Intergenic
956700928 3:71957841-71957863 CTTTATCAGCAGTGTGAGGATGG - Intergenic
958940090 3:100302171-100302193 TTTTATGGGCAGTGGCAGGGAGG + Exonic
961804023 3:129475969-129475991 CTATATTTGCAGAGGGAGGGGGG + Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
963085711 3:141434382-141434404 CTGTGTGTGCACTGGGGGGGCGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967293554 3:187944607-187944629 CTGAATGAGAAGTGAGAGGGCGG + Intergenic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
967749745 3:193100534-193100556 CTTTATTAGCAGTGTGAGAGTGG + Intergenic
968511950 4:999717-999739 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968511971 4:999803-999825 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968511992 4:999889-999911 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968512015 4:999976-999998 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968512059 4:1000149-1000171 CTGCAAGTGCAGTGGCAGGGTGG + Intronic
968914271 4:3490374-3490396 CTGAATGAGCAGGGGGTGGGGGG - Intronic
968952527 4:3702368-3702390 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968952554 4:3702440-3702462 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
970322226 4:14886151-14886173 ATGTCTGAGCAGTGGTGGGGAGG - Intergenic
971111776 4:23592939-23592961 CTTTATTAGCAGTGGGAGAATGG + Intergenic
971278561 4:25221669-25221691 CTTTATTAGCAGTGGGAGAATGG - Intronic
971287745 4:25306740-25306762 CTGTATGAGCAGGCTGAGGCTGG + Intergenic
971996704 4:33974720-33974742 CTGTATTAGCAGTGTGAGAATGG - Intergenic
972302090 4:37794013-37794035 TTGTGTGAGCAGTGGGTGGTTGG - Intergenic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974143348 4:57917216-57917238 CTTTATGAGCAGTGTGAGAACGG + Intergenic
974467237 4:62272924-62272946 ATGGATGAGAAGTGGGAGGAAGG - Intergenic
976027013 4:80700406-80700428 CAGTATTATCAGTGGGATGGTGG + Intronic
976300906 4:83514646-83514668 CAGTATGAGCAGTTGGCTGGGGG - Intronic
976319241 4:83692687-83692709 CTTTATGACGAGTGGAAGGGAGG - Intergenic
982068025 4:151671814-151671836 CTGTGTGGGCAGGGGGAGTGAGG + Intronic
983346151 4:166527240-166527262 CTGTAAGTGGGGTGGGAGGGTGG - Intergenic
984075366 4:175170945-175170967 CTGTATCTGCAGTGGAAGGAAGG - Intergenic
984256111 4:177391952-177391974 CTGTATAGGAAGTTGGAGGGGGG + Intergenic
985718870 5:1478549-1478571 CTGGATGGGCAGTGGCCGGGAGG - Intronic
986224654 5:5801498-5801520 TTGTCTGTGCAGTGGGATGGAGG + Intergenic
991419389 5:66426017-66426039 CTGTAAGGGTAGTGGGTGGGTGG + Intergenic
992677033 5:79115540-79115562 TTGTATGTGCTGTGGGTGGGGGG - Intronic
995337822 5:111022441-111022463 ATGTATCAGCAGTGGGATTGGGG - Intergenic
995581364 5:113606404-113606426 CTGATTGAGCAGTTGGAGGCGGG - Intergenic
998161092 5:139813470-139813492 CTGGATGAGGGGTGTGAGGGGGG - Exonic
998569613 5:143245418-143245440 CTGTATTAGCAGTGTGAGAACGG + Intergenic
998608279 5:143659670-143659692 CTGTATCAGCAGTGTCTGGGAGG - Intergenic
998941612 5:147289096-147289118 CTGTATGTGCAGTGTCAAGGGGG + Intronic
999448420 5:151659850-151659872 CTGCAGCAGGAGTGGGAGGGAGG + Intergenic
1000914619 5:167065527-167065549 GTGTATGAGTAGTGTGAGTGAGG + Intergenic
1001172878 5:169437868-169437890 CTGGATGAGCTGTGTGAGCGTGG + Intergenic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1001802198 5:174554180-174554202 CTGTGTTAGCAGTGGTTGGGAGG - Intergenic
1002961164 6:1916008-1916030 CTGCGTGAGCAGTGGCTGGGCGG - Intronic
1003036732 6:2646507-2646529 GTGCATGTGTAGTGGGAGGGTGG + Intergenic
1004581290 6:16956047-16956069 CTGTATGTGTAGGTGGAGGGAGG + Intergenic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1008631407 6:53365936-53365958 CTGTAAGAGCAGTCAGAAGGAGG - Intergenic
1010372762 6:75130767-75130789 TTGAATGAGTGGTGGGAGGGGGG - Intronic
1011300004 6:85863920-85863942 CTTTAACAGCAGTGGGAGTGGGG + Intergenic
1012645347 6:101672147-101672169 TTGTGTCATCAGTGGGAGGGAGG - Intronic
1013147104 6:107404448-107404470 CTTTATTAGCAGTGGGAGAACGG - Intronic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015973986 6:138770885-138770907 ATGTATGAGTACTGGGAGGCAGG + Intronic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1024585160 7:50835764-50835786 CTGAATAAGCACTGGGAGGTGGG - Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1027670723 7:81093688-81093710 CTGTATGAGGATTTGTAGGGTGG + Intergenic
1028077443 7:86533953-86533975 CTGCAGGGGCAGTGGGAGAGGGG + Intergenic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1033095917 7:138430594-138430616 CTTTATTAGCAGTGGGAGAACGG + Intergenic
1033662671 7:143413145-143413167 CCGTGTGGGCTGTGGGAGGGAGG + Intergenic
1034525114 7:151654442-151654464 CTATATGGACAGTGGGAGGAAGG - Intronic
1034982731 7:155489079-155489101 CTAAATGAGAAGTGGCAGGGAGG - Intronic
1035264894 7:157685178-157685200 CGGGATGAGGGGTGGGAGGGCGG - Intronic
1035311613 7:157973160-157973182 CTGGAGCAGCAGTGGGTGGGAGG + Intronic
1035444782 7:158932845-158932867 TTATAGGAGCAGTGGGAGGGAGG + Intronic
1036441298 8:8783226-8783248 CTGTTGGAGCTGTGGGAGGTGGG - Intergenic
1038546327 8:28428253-28428275 CTGCATGAGCAGTTGAATGGAGG - Intronic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1040969099 8:53114507-53114529 CTGTGTGGGCAGTGGGCTGGGGG - Intergenic
1041569812 8:59324733-59324755 CTGTATCAGCATTGTGATGGAGG - Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1043057232 8:75454122-75454144 CTGTATGTGGAGTGGGGGAGAGG - Intronic
1046140823 8:110089262-110089284 CTTTATTAGCAGTGTGAGAGTGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048351233 8:133618355-133618377 CTGTATGGTGAGTGTGAGGGTGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053885925 9:42645209-42645231 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054224943 9:62452658-62452680 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1055435294 9:76286703-76286725 CTGTAGGAGCACTTGGAGGTAGG + Intronic
1055960480 9:81815940-81815962 CTGAATTAGCAGTGGGTGGTGGG - Intergenic
1055984296 9:82040353-82040375 TGGTAGGAGCAGTGGGAGTGAGG + Intergenic
1057211048 9:93201315-93201337 CTGGAGGAGCAGGGGGAGTGGGG + Intronic
1057449084 9:95140577-95140599 CTGTCTGAGCAGTAGAGGGGAGG + Intronic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1059333065 9:113548670-113548692 CTGTATGAGGAGGGGGTGTGAGG - Intronic
1059614641 9:115935616-115935638 CTGTATTAGCAGTGTGAGAATGG + Intergenic
1059800350 9:117744117-117744139 CTGTATGGACAGTGGGACAGTGG + Intergenic
1060745070 9:126125985-126126007 CTGTATCAGCCCTGGGAGGGGGG - Intergenic
1060834660 9:126745997-126746019 CTGCAGTGGCAGTGGGAGGGTGG + Intergenic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1188615586 X:32155231-32155253 GCGTGTGAGCAGTGGGTGGGAGG - Intronic
1190109582 X:47581502-47581524 ATGAATGAGCATTGGGAAGGGGG - Intronic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1197148791 X:123197045-123197067 TTGTAAGAGCAATAGGAGGGTGG + Intronic
1198556905 X:137804530-137804552 CTGTATGTGTTGTGGGATGGTGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200334455 X:155335026-155335048 CTGTGTGAGCAGTAGGATTGGGG - Intergenic