ID: 1173827831

View in Genome Browser
Species Human (GRCh38)
Location 20:46058598-46058620
Sequence CGGTGCCTTCGCTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173827817_1173827831 -1 Left 1173827817 20:46058576-46058598 CCCCACCGAGGAAGCCCCGCCCC 0: 1
1: 0
2: 2
3: 29
4: 259
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827811_1173827831 29 Left 1173827811 20:46058546-46058568 CCTCAAGAGGAAGAAACCGAGAG 0: 1
1: 0
2: 0
3: 16
4: 186
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827815_1173827831 5 Left 1173827815 20:46058570-46058592 CCCGCGCCCCACCGAGGAAGCCC 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827819_1173827831 -3 Left 1173827819 20:46058578-46058600 CCACCGAGGAAGCCCCGCCCCGG 0: 1
1: 0
2: 3
3: 24
4: 207
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827818_1173827831 -2 Left 1173827818 20:46058577-46058599 CCCACCGAGGAAGCCCCGCCCCG 0: 1
1: 0
2: 1
3: 16
4: 110
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827813_1173827831 13 Left 1173827813 20:46058562-46058584 CCGAGAGGCCCGCGCCCCACCGA 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827821_1173827831 -6 Left 1173827821 20:46058581-46058603 CCGAGGAAGCCCCGCCCCGGTGC 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149
1173827816_1173827831 4 Left 1173827816 20:46058571-46058593 CCGCGCCCCACCGAGGAAGCCCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173827831 Original CRISPR CGGTGCCTTCGCTGGGGAGC AGG Intronic
900084602 1:885741-885763 CTGTGCCCTTGCTGGGGAGGTGG + Intergenic
900096652 1:942637-942659 CGGCGCCGTCGTTGGGGCGCAGG - Exonic
900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG + Intronic
900309712 1:2027848-2027870 CTGTGCCCTGCCTGGGGAGCCGG + Intronic
900987900 1:6083662-6083684 CAGTGCCCTCACAGGGGAGCTGG + Intronic
901961256 1:12828345-12828367 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901967849 1:12882950-12882972 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901975653 1:12942080-12942102 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901983247 1:13053215-13053237 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901985762 1:13074117-13074139 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
901996047 1:13152650-13152672 CAGTGCTTTCCCTGAGGAGCTGG + Intergenic
901998842 1:13175703-13175725 CAGTGCTTTCCCTGAGGAGCTGG - Intergenic
902009521 1:13259685-13259707 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
902017327 1:13318830-13318852 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
902977881 1:20101982-20102004 CGGTTGCATCACTGGGGAGCTGG - Intergenic
903270436 1:22185154-22185176 CGGTGCGTTGCCTGGGGAGCTGG + Intergenic
903333440 1:22609241-22609263 CGGGGCCTTTGGTGGGGAGCAGG + Intergenic
904513734 1:31036576-31036598 AAGTGCCTTGACTGGGGAGCAGG - Intronic
905532911 1:38696272-38696294 CTTTGCCTTAACTGGGGAGCAGG - Intergenic
905532923 1:38696328-38696350 CTTTGCCTTAACTGGGGAGCAGG - Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
912818720 1:112850164-112850186 GGGAGCCGGCGCTGGGGAGCCGG + Intergenic
913959201 1:143326483-143326505 CACTGCCTTTGGTGGGGAGCCGG - Intergenic
914053518 1:144151863-144151885 CACTGCCTTTGGTGGGGAGCCGG - Intergenic
914125679 1:144814678-144814700 CACTGCCTTTGGTGGGGAGCCGG + Intergenic
919972754 1:202591492-202591514 CTGGGGCTTCTCTGGGGAGCAGG + Exonic
1063171856 10:3516395-3516417 CAGAGGCTTCACTGGGGAGCTGG - Intergenic
1071517804 10:86310548-86310570 CAGTGCCCTTGCTGAGGAGCAGG + Intronic
1074492818 10:113954376-113954398 CTGTGCATTCTCTTGGGAGCTGG + Intergenic
1075614826 10:123883287-123883309 CAGCACCTTCGCTGGGGAGGAGG + Intronic
1076908878 10:133377744-133377766 CAGGACCTCCGCTGGGGAGCTGG + Intergenic
1077025473 11:438086-438108 CGGTGTCTTTGGTGGGGAGGGGG - Intronic
1077366230 11:2162416-2162438 AGGTGCCTGTTCTGGGGAGCTGG - Intergenic
1077494311 11:2879044-2879066 CAGTCCCTTCGCTGGAGGGCTGG + Intergenic
1079076390 11:17387773-17387795 CAGTGCCCTCGCTGGGGGCCAGG + Exonic
1081730952 11:45371485-45371507 CGGTGCCCTCGCAGTGCAGCAGG + Intergenic
1089737094 11:120557016-120557038 CGGTGCCTTCTGTGGGCAGGAGG - Intronic
1101963304 12:109265659-109265681 TGGTCTCTTTGCTGGGGAGCGGG - Intronic
1104946225 12:132415946-132415968 CGGTGGCGTCTCTGGGGACCAGG + Intergenic
1106242828 13:27924257-27924279 CGGCGCCTACGCTGCGGAGCCGG + Exonic
1108436118 13:50403212-50403234 CTGTGCCTTTGCTGGGAAGCTGG + Intronic
1111922550 13:94427481-94427503 CGCTGCCTTCTCAGGGGTGCTGG - Intergenic
1113295506 13:108955124-108955146 TGGTGCCATCTCAGGGGAGCAGG - Intronic
1113382412 13:109816003-109816025 CAGTGCCTTCTCTGTGCAGCTGG - Intergenic
1119147112 14:72327275-72327297 AGCTGCCTTCTCTGTGGAGCAGG + Intronic
1119524446 14:75311022-75311044 CAGTGCCTTCTCTCAGGAGCTGG + Intergenic
1120501887 14:85307837-85307859 CGGTGCCTCCGGTGAGGAGCTGG + Intergenic
1121012924 14:90532705-90532727 AGGTACCTGGGCTGGGGAGCTGG - Exonic
1122111749 14:99508326-99508348 CTGTGCCTTCACTGAGGAGATGG + Exonic
1122981572 14:105194527-105194549 CGGGGCCAGCGCTGGGCAGCTGG - Intergenic
1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG + Intergenic
1126848919 15:52785966-52785988 CGGTTCCTTCGCTCCGCAGCGGG - Intronic
1130010513 15:80149850-80149872 CGCTGCCTGCACTGGGAAGCAGG - Intergenic
1132205567 15:99984020-99984042 CTGTGCCGTCGCTGGGAAACAGG + Intronic
1132326373 15:100973600-100973622 CGGTGCCTTCGCAGCGGCCCCGG + Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1132976470 16:2713609-2713631 CGGTGTCTTTGCTGTAGAGCAGG + Exonic
1133102009 16:3485518-3485540 CGGTGCATGCGCAGGGGGGCAGG - Exonic
1135415557 16:22265898-22265920 TGGTGCCTTATATGGGGAGCTGG + Intronic
1137579248 16:49623262-49623284 AGGCGCCTTGGCTGGGGGGCTGG - Intronic
1138359386 16:56414547-56414569 CTGTGACTTAGCTGGTGAGCTGG - Intronic
1139795921 16:69482749-69482771 CACTGCCTTCCCTGGGGACCTGG + Intergenic
1141357569 16:83362813-83362835 CACAGCCTTGGCTGGGGAGCAGG - Intronic
1141582771 16:85011493-85011515 CGGAGCCTTGGCTGGAGAGCGGG + Exonic
1142620231 17:1160971-1160993 CGGTGCCTTCTGAGGGAAGCGGG + Intronic
1143223761 17:5282696-5282718 GGCTGCCGTCGCTGGGGAGGGGG + Intronic
1143452381 17:7043560-7043582 CTGTGCTTCCGCTGGGGAGCTGG + Exonic
1146604420 17:34246168-34246190 CTCTGCCTTCACTGGGGAGGAGG + Intergenic
1147644758 17:42027052-42027074 CAGTGGCTGCGGTGGGGAGCGGG + Exonic
1148555401 17:48576158-48576180 GGGTGCTTTCGCTGGGTATCGGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149037595 17:52153100-52153122 CAGTCCCTTGGCTGGGGAGAGGG - Intronic
1151763799 17:76121992-76122014 CGGGGGCTGCGCTGGGCAGCGGG + Intergenic
1152202090 17:78953013-78953035 CTGTGCCTTCGCTGGGGCTCAGG - Intergenic
1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG + Intronic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160739652 19:680040-680062 CTGCGCCTGCGCTGGGGGGCGGG - Intronic
1160895917 19:1401691-1401713 CGGTGCCCCCTCTGCGGAGCGGG + Intergenic
1161013344 19:1970560-1970582 GGGTGCCTTCCCTGGGGTGGGGG + Intronic
1161171636 19:2815196-2815218 CTGGGACTTCGCTGGGGACCAGG - Exonic
1161344547 19:3761579-3761601 CGGGGCCGTCCGTGGGGAGCGGG - Exonic
1161382930 19:3976014-3976036 CGGTGTCTTCGCAGGGGAGCGGG - Intergenic
1161557949 19:4955092-4955114 GGGTGCCGGAGCTGGGGAGCGGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163091448 19:15022855-15022877 CGGTGCCCTGGATAGGGAGCAGG - Exonic
1164918625 19:32071961-32071983 AGGTGACTTCGCTGGGGCCCTGG + Intergenic
1165860200 19:38905369-38905391 CGGGGGCTTCCCTGGGGCGCCGG - Exonic
1202692917 1_KI270712v1_random:104286-104308 CACTGCCTTTGGTGGGGAGCCGG - Intergenic
925141198 2:1550835-1550857 AGGTGCCCGCGCTTGGGAGCGGG - Intergenic
927809474 2:26173437-26173459 CGGGGCCCACGCCGGGGAGCTGG - Intronic
928186001 2:29111430-29111452 CTTTTCCTTCCCTGGGGAGCGGG + Intronic
931009035 2:57886464-57886486 CGGTGGCTTGGCAGGGGAGGTGG + Intergenic
933953484 2:87349681-87349703 CACTGCCTTTGGTGGGGAGCCGG + Intergenic
934237691 2:90245929-90245951 CACTGCCTTTGGTGGGGAGCCGG + Intergenic
934275512 2:91570802-91570824 CACTGCCTTTGGTGGGGAGCCGG - Intergenic
934518688 2:95005838-95005860 CGTGGCCTTCCCTGGGCAGCAGG + Intergenic
936521068 2:113212501-113212523 GGGTGCCTTGGCTGTGGAGAAGG + Intergenic
938210044 2:129459560-129459582 CAGTGCCTTCCCTGGGGACCTGG + Intergenic
938639596 2:133265792-133265814 CTCTGACCTCGCTGGGGAGCAGG + Intronic
939969526 2:148644513-148644535 CGGTGCTTTCGCTGTGTGGCAGG - Intronic
940657271 2:156503093-156503115 TGGTGCCTTGGCTGTGGTGCTGG + Intronic
944547552 2:200812382-200812404 CGCTGCTTTCGCTGGAGGGCGGG + Exonic
948534601 2:238636548-238636570 GGCTGCCTCCACTGGGGAGCAGG - Intergenic
948666770 2:239539746-239539768 CTGTGCCTTCACTGTGGTGCTGG - Intergenic
1171244426 20:23599826-23599848 TGGTGCCTTTGCTGGGTAGTAGG + Intergenic
1171774874 20:29355776-29355798 CTGTGCCCTTGCTGGGGAGGTGG - Intergenic
1173552574 20:43943128-43943150 CCCTGCCTTCTCTGTGGAGCTGG + Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1174518089 20:51108774-51108796 CTCTGCCTGTGCTGGGGAGCAGG + Intergenic
1174735159 20:52959303-52959325 GGGTGCCATCTCTGGAGAGCTGG + Intergenic
1175181881 20:57154211-57154233 CGGTGCCTTCGTGTGGGAGGAGG + Intergenic
1175462709 20:59165126-59165148 CTGTGCTTCCGCTGGGAAGCTGG + Intergenic
1175852890 20:62103525-62103547 CGGTGCTAATGCTGGGGAGCGGG - Intergenic
1178843748 21:36157346-36157368 TGGTGCCCTGGCTGGGGAGGAGG + Intronic
1179973046 21:44846977-44846999 CCATGCATTCGCTGGGGAACAGG - Intergenic
1180077177 21:45468797-45468819 CTGTGCCGTCGCTGGGGGACTGG + Intronic
1180985139 22:19899561-19899583 CAGTCCCCTCTCTGGGGAGCTGG - Intronic
1181299302 22:21867847-21867869 CGGTGCATTCGCGGGGGCGTCGG + Intergenic
1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG + Exonic
1183665586 22:39244145-39244167 CGGCTCCGTCGCTGGGGGGCAGG + Exonic
951591175 3:24266661-24266683 TGTTGCCTTTGCTGGGGACCTGG - Intronic
952325357 3:32315527-32315549 GGGTGCCTTCGCTGAGCACCTGG - Intronic
955936595 3:64108596-64108618 CGATGCCATCCCTTGGGAGCTGG + Intronic
962359430 3:134725443-134725465 CTGCCCCTTCGGTGGGGAGCAGG - Intronic
966711948 3:182980522-182980544 CCGTCCATTCGCTGCGGAGCCGG - Exonic
967105660 3:186253092-186253114 CGTTGTCTCCGCTGGGGAGGAGG - Exonic
967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG + Exonic
968358903 3:198132946-198132968 CTGTGCCCTTGCTGGGGAGGTGG + Intergenic
968969235 4:3784800-3784822 CTGTGGCTGCACTGGGGAGCGGG - Intergenic
969191702 4:5526550-5526572 TGGGGCCTTCCCTGGAGAGCTGG + Intronic
981550293 4:145936640-145936662 CGGTGCCTGCCCAGGGGACCGGG - Intronic
982202516 4:152974349-152974371 CAGTGCCTTGGCTGGAAAGCTGG + Intronic
985129031 4:186723643-186723665 CGGTTAGTTCGCTGGGGCGCGGG - Exonic
985669580 5:1200603-1200625 CGGCCTCTTTGCTGGGGAGCAGG + Intergenic
985703510 5:1387470-1387492 CGGTGCCTGACTTGGGGAGCTGG - Intergenic
985914297 5:2905891-2905913 CTGTGCCTTCGGTAAGGAGCTGG + Intergenic
991124414 5:63053284-63053306 CAGTGCCTTTGCAGGGCAGCTGG - Intergenic
995546452 5:113236846-113236868 GGGTGGCTTCGCTGGGAGGCTGG + Intronic
997527094 5:134560433-134560455 CAGTGCCTTCTCCGTGGAGCTGG + Intronic
999246611 5:150158316-150158338 CGGTGGCTCCCCTGGGAAGCTGG + Intergenic
1001961349 5:175882054-175882076 CTGTCCCTTCTTTGGGGAGCAGG + Exonic
1005019784 6:21406761-21406783 AGGTGTGTTGGCTGGGGAGCCGG - Intergenic
1007647122 6:43391602-43391624 CTGTGGCTTCTGTGGGGAGCCGG - Intergenic
1008003825 6:46388786-46388808 CGGGGCCTGTGTTGGGGAGCCGG + Intronic
1010954160 6:82071312-82071334 CGGTGCCTGCTCTGTGCAGCTGG - Intergenic
1019045008 6:169139255-169139277 GGGTGGGTTCGCTGGGGAGGAGG + Intergenic
1020210651 7:6155660-6155682 CGATGCCTACGCTGGGCAGGCGG - Intronic
1020211302 7:6159839-6159861 AGGTGCCTGTGCTGGGGACCGGG - Intronic
1023792958 7:43768458-43768480 CAGTGCCTTGGCTGTGAAGCAGG + Intronic
1028364150 7:90007431-90007453 CAGTGACTTTGCTGGGGACCAGG - Intergenic
1032382651 7:131501062-131501084 CTGTGACTTTGCTGGGGAGGGGG + Intronic
1039840438 8:41289153-41289175 AGGGGCCTTGCCTGGGGAGCAGG + Intronic
1039880299 8:41621411-41621433 CTGTGCCTTTCCTGGAGAGCGGG - Exonic
1049494956 8:142925614-142925636 GGGTGCCTGTGCTGGGGAGGTGG + Intergenic
1056095433 9:83248449-83248471 GGCTGCCTTCACTGGGGAGCTGG + Exonic
1056324928 9:85469261-85469283 CGGTGCCTGCGTTGGGGAAGGGG - Intergenic
1057878335 9:98774411-98774433 AGGTGCCTTCACTGTGCAGCAGG - Intronic
1060855883 9:126914890-126914912 CGGCGCCTTCGCTTGGAGGCCGG - Exonic
1062155416 9:135045612-135045634 TGGTGCCCTCGCTGGGGATGAGG + Intergenic
1062431511 9:136528701-136528723 CTGTGGCTCTGCTGGGGAGCAGG - Intronic
1186218690 X:7326525-7326547 TGGGGCCTTAGCTGGGGACCCGG - Intronic
1193654912 X:84187661-84187683 CTGCCCTTTCGCTGGGGAGCGGG - Intronic
1199085249 X:143620914-143620936 CAGTGCCTTCGCTTGTGAGCTGG - Intergenic