ID: 1173827898

View in Genome Browser
Species Human (GRCh38)
Location 20:46058852-46058874
Sequence CAGAGCACGGAGAAGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173827898_1173827910 24 Left 1173827898 20:46058852-46058874 CCAGCCGCCTTCTCCGTGCTCTG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827898_1173827911 25 Left 1173827898 20:46058852-46058874 CCAGCCGCCTTCTCCGTGCTCTG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1173827911 20:46058900-46058922 GGCCTCTAGCTCCGTCTCCCGGG 0: 1
1: 0
2: 2
3: 202
4: 5975
1173827898_1173827912 26 Left 1173827898 20:46058852-46058874 CCAGCCGCCTTCTCCGTGCTCTG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1173827912 20:46058901-46058923 GCCTCTAGCTCCGTCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 124
1173827898_1173827908 4 Left 1173827898 20:46058852-46058874 CCAGCCGCCTTCTCCGTGCTCTG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1173827908 20:46058879-46058901 CGGGCCTCGCTGCTTAGCAGCGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173827898 Original CRISPR CAGAGCACGGAGAAGGCGGC TGG (reversed) Intronic
900349797 1:2228869-2228891 CAGCGCGCCGAGAAAGCGGCCGG - Exonic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903603065 1:24556162-24556184 CAGAGCAGGTAGGAGGCGCCTGG + Exonic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG + Exonic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG + Intergenic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
912431762 1:109631753-109631775 GACAGGACGGAGAAGGCTGCTGG - Exonic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
921472616 1:215567403-215567425 CGGAGCACGGAGAAGAGGCCCGG + Exonic
922727085 1:227927591-227927613 CAGAGCACGGCTAGGGCGGGAGG + Intronic
922758103 1:228107837-228107859 CAGAGCACCGTGAAGGCCACCGG - Exonic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1066649712 10:37642829-37642851 CAGAGCACCGAGCAGGCTCCTGG - Intergenic
1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1070189980 10:74103162-74103184 AAGAGCACAGAGGAGTCGGCCGG - Intronic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG + Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075438506 10:122461801-122461823 CGGAGCACTGCGAGGGCGGCCGG + Exonic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1077060787 11:617069-617091 CAGAGCCTCGGGAAGGCGGCGGG + Exonic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089433199 11:118438565-118438587 CAGAGCACGCAGGAAACGGCTGG - Intronic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091346315 11:134856688-134856710 CAGTGCACGTAGAATGTGGCTGG + Intergenic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1094414178 12:30200976-30200998 AAGAGCACGGAGCCGGCGACTGG + Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1110119372 13:71864817-71864839 GCGCGCACGGAGGAGGCGGCGGG - Intronic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1113895158 13:113759440-113759462 CAGAGCTCGAAGGAGGCGGAGGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114656750 14:24320517-24320539 GAGAGCAGGGAGCAGGCGGTGGG + Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1121168697 14:91835873-91835895 CCGAGCACGGAGCAGGGAGCCGG + Intronic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124365870 15:29071407-29071429 CATCACTCGGAGAAGGCGGCAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1128065889 15:64764182-64764204 CACAGCACCAAGAAGGCTGCAGG - Intronic
1129226874 15:74175280-74175302 CAGAGCACGGAGGCTGCGGAAGG - Exonic
1132788010 16:1668910-1668932 CCCACCACGGAGAAGGCAGCAGG - Intronic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133164889 16:3939294-3939316 CAGAGCAGGGAGACCCCGGCTGG - Intergenic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136547851 16:30965594-30965616 AAGAGCATGGAGAAGCCTGCGGG - Exonic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141633111 16:85299577-85299599 CAGAGAACGGAGTAGGCAGAGGG - Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1145063133 17:19744771-19744793 CAGAGGGCGGAAGAGGCGGCGGG + Intronic
1146126583 17:30235968-30235990 CGGAGCGCGGAGCAGCCGGCAGG + Exonic
1147037381 17:37691872-37691894 CAGGGCACTGACAAGGGGGCAGG - Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1149430633 17:56593769-56593791 CGGAGCCCGGAGCAGGCGGAGGG + Exonic
1151558908 17:74860600-74860622 CAGAGACCGGCGCAGGCGGCTGG + Intronic
1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG + Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152896469 17:82914217-82914239 CAGAGCACCGAGAACCCGGATGG - Intronic
1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG + Intergenic
1153660670 18:7323065-7323087 CAGACCACGAAGTAGGCAGCTGG - Intergenic
1153868680 18:9296978-9297000 CAGATCCGGGAGAAGCCGGCAGG - Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1156448482 18:37253690-37253712 CGGAGGCCGGAGGAGGCGGCGGG + Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG + Intronic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1160972074 19:1773986-1774008 CAGATCACGGAGAGGGCTGAAGG - Intronic
1161225941 19:3146028-3146050 CGGAGCACGGAGAAGGGGCGGGG - Intronic
1162757908 19:12871255-12871277 AAGAGCACGGGAAAGGTGGCGGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163625718 19:18388358-18388380 CAGAGCCCGGTGAAGGCGGGAGG - Exonic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
1168670621 19:58238518-58238540 GAGAGCACGCAGGAGGCGTCAGG + Intronic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
925919377 2:8628512-8628534 CATGGCACGGAGAAGGCAGTTGG + Intergenic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
929562510 2:42964603-42964625 CAGAGCTGGGTGGAGGCGGCTGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946391308 2:219418416-219418438 GGGCGCACGGAGGAGGCGGCGGG - Exonic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947549772 2:231037812-231037834 CAGAGGGCGGCGAGGGCGGCTGG + Exonic
947827208 2:233114509-233114531 CAGAGCAGGGCAAACGCGGCAGG + Intronic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
948945017 2:241215047-241215069 CAGAGCCCGGGGCAGACGGCCGG - Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1173210751 20:41029497-41029519 CAGGGCGCGGGGGAGGCGGCCGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176377562 21:6094050-6094072 CAGCACATGGAGAACGCGGCAGG - Intergenic
1176549845 21:8216464-8216486 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1176557737 21:8260693-8260715 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1176568771 21:8399498-8399520 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1176576685 21:8443733-8443755 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180664541 22:17499382-17499404 CAGAGCACGGAAAAGGGGTTTGG - Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182866184 22:33606577-33606599 GAGAGCACGGGGTAGGGGGCGGG - Intronic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1183455973 22:37923567-37923589 CAGAGCACGGCAGAGGCTGCAGG - Intronic
1184320855 22:43741207-43741229 CAGAGCCCGGAGACCGTGGCTGG - Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184677974 22:46053848-46053870 CGGAGCACGGAGGACGGGGCCGG + Exonic
1203254735 22_KI270733v1_random:132790-132812 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG + Exonic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG + Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
954186279 3:48919199-48919221 CCGAGAGCTGAGAAGGCGGCGGG - Exonic
955687537 3:61561986-61562008 CAGGGCGCGGAGTCGGCGGCCGG - Exonic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969715829 4:8867724-8867746 AAGGGCACGGAGGCGGCGGCCGG + Exonic
971196221 4:24473126-24473148 AGGAGGTCGGAGAAGGCGGCCGG - Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
981615371 4:146638996-146639018 CAGAGTCCGGAGGCGGCGGCGGG + Exonic
982105417 4:152007879-152007901 CAGAACACAGGAAAGGCGGCAGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985754373 5:1704436-1704458 AAGAGAACGGAGAAGGCAGTGGG - Intergenic
986236412 5:5914635-5914657 CAGAGCAGGTAGAAGGCATCCGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
991940886 5:71850933-71850955 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003897026 6:10617293-10617315 CAGCACTCGGAGAAGCCGGCCGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1006378806 6:33685996-33686018 TACAGCACGGAGAGGGAGGCTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1021573866 7:22090454-22090476 CGGATCCCGGAGAAGCCGGCAGG - Intergenic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1030820163 7:114084930-114084952 CGGCGCGCGGAAAAGGCGGCCGG + Intergenic
1031924832 7:127629440-127629462 CAGAGCACTGGGTAGGCTGCAGG - Intergenic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035355878 7:158275983-158276005 CATAGCACGTGTAAGGCGGCGGG - Intronic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG + Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049358862 8:142202355-142202377 CAGAGGGCGGAGACGGCGGCTGG - Intergenic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG + Intergenic
1051469986 9:17427207-17427229 CAGAGCACGGAGCATGTGACTGG - Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060968472 9:127724622-127724644 GAGAGGACGGAGACTGCGGCGGG + Intronic
1061577662 9:131517616-131517638 CAGAGCACAGAGACGGCGAGTGG - Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1203772864 EBV:58228-58250 CAGAGGCCGGAGACGACGGCGGG + Intergenic
1203471136 Un_GL000220v1:115935-115957 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1203478957 Un_GL000220v1:159907-159929 CCGATCCCGGAGAAGCCGGCGGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1192236474 X:69299447-69299469 AAGAGCACAGAGTAGGCGACTGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic