ID: 1173827910

View in Genome Browser
Species Human (GRCh38)
Location 20:46058899-46058921
Sequence CGGCCTCTAGCTCCGTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 552}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173827898_1173827910 24 Left 1173827898 20:46058852-46058874 CCAGCCGCCTTCTCCGTGCTCTG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827897_1173827910 25 Left 1173827897 20:46058851-46058873 CCCAGCCGCCTTCTCCGTGCTCT 0: 1
1: 0
2: 1
3: 22
4: 183
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827903_1173827910 17 Left 1173827903 20:46058859-46058881 CCTTCTCCGTGCTCTGGGGCCGG 0: 1
1: 0
2: 1
3: 21
4: 182
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827906_1173827910 11 Left 1173827906 20:46058865-46058887 CCGTGCTCTGGGGCCGGGCCTCG 0: 1
1: 0
2: 1
3: 17
4: 244
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827907_1173827910 -2 Left 1173827907 20:46058878-46058900 CCGGGCCTCGCTGCTTAGCAGCG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827902_1173827910 20 Left 1173827902 20:46058856-46058878 CCGCCTTCTCCGTGCTCTGGGGC 0: 1
1: 0
2: 2
3: 32
4: 298
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552
1173827909_1173827910 -7 Left 1173827909 20:46058883-46058905 CCTCGCTGCTTAGCAGCGGCCTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG 0: 1
1: 0
2: 2
3: 25
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173827910 Original CRISPR CGGCCTCTAGCTCCGTCTCC CGG Intronic
900394419 1:2447310-2447332 CTGCCTTCAGCTCCTTCTCCCGG + Intronic
901565634 1:10112422-10112444 CGGAGTCTCGCTCTGTCTCCCGG + Intronic
901592473 1:10356872-10356894 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
901706744 1:11079301-11079323 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
902233654 1:15044126-15044148 CGGCCTCCAGCTCCTTCATCCGG - Exonic
903307145 1:22420915-22420937 CGGCGTCTCGCTCTGTCGCCAGG + Intergenic
903411745 1:23149934-23149956 CGGAGTCTGGCTCCGTCACCAGG - Intronic
903570739 1:24302980-24303002 TGGCGTCTCGCTCCGTCTCCAGG - Intergenic
903865505 1:26394638-26394660 CGGAGTCTTGCTCTGTCTCCTGG - Intergenic
904138608 1:28333832-28333854 CGGAGTCTAGCTCTGTCTTCAGG - Intronic
904171095 1:28592619-28592641 CGGGCTCGGGCTCCGGCTCCGGG - Intronic
904681954 1:32235354-32235376 CGGAATCTTGCTCTGTCTCCAGG + Intergenic
904722733 1:32522774-32522796 CGGCGTCTCGCTCAGTCACCAGG - Intronic
906651773 1:47517872-47517894 CTGCCTCCTGGTCCGTCTCCTGG + Intergenic
907383338 1:54109384-54109406 TGGCCTCTACCTCCTTCTCCAGG - Intronic
907449292 1:54532876-54532898 CAGGGTCTAGCTCCGTCGCCCGG - Intergenic
908515279 1:64885726-64885748 CGGACTCTTGCTCTGTCACCAGG - Intronic
909324104 1:74327053-74327075 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
910187183 1:84556684-84556706 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
910484529 1:87698198-87698220 CGGAGTCTCGCTCTGTCTCCAGG - Intergenic
911616326 1:100016088-100016110 CGGAGTCTAGCTCTGTCACCAGG + Intronic
912146032 1:106795450-106795472 CGGACTCTCACTCTGTCTCCAGG - Intergenic
912201336 1:107461562-107461584 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
912840392 1:113034139-113034161 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
912903088 1:113673883-113673905 CAGCCTCTAGTTACCTCTCCCGG - Intronic
913456416 1:119036126-119036148 CAGCCTCCACCTCCGCCTCCGGG - Intronic
913673944 1:121123999-121124021 CGGACTCTCGCTCTGTCCCCAGG + Intergenic
914025725 1:143911351-143911373 CGGACTCTCGCTCTGTCCCCAGG + Intergenic
914664163 1:149819079-149819101 CGGACTCTCGCTCTGTCCCCAGG + Intergenic
914671600 1:149874763-149874785 CGGACTCTCGCTCTGTCCCCAGG - Intronic
914808250 1:151007476-151007498 CGGAGTCTTGCTCCGTCTTCAGG - Intronic
915253916 1:154610782-154610804 CGGTGTCTTGCTCTGTCTCCAGG - Intronic
915262734 1:154690064-154690086 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
915333182 1:155126174-155126196 CGGCCTCTAACCCCGTGGCCGGG - Intergenic
916815246 1:168345441-168345463 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
916877226 1:168982345-168982367 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
917916239 1:179705371-179705393 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
917932554 1:179833157-179833179 CAGAGTCTAGCTCCGTCACCTGG - Intergenic
918369892 1:183849514-183849536 TGGCATCTCGCTCTGTCTCCAGG + Intronic
918372001 1:183870253-183870275 CGGCCTCTTTCTCGGTCTTCAGG + Intronic
919084071 1:192900110-192900132 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
919391978 1:196997118-196997140 CCGCCTCTCTCTCCATCTCCTGG + Intronic
920493906 1:206440571-206440593 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
921277918 1:213537602-213537624 GGGACTCTAGCTCAGACTCCTGG - Intergenic
922056251 1:222045094-222045116 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
922288790 1:224192977-224192999 CAGCCTCTGCCTCCGCCTCCTGG - Exonic
922603032 1:226871122-226871144 CGGCCTCTAGCACCGGGTCCTGG + Intronic
922667281 1:227481513-227481535 AGGAGTCTAGCTCTGTCTCCAGG - Intergenic
923035097 1:230280155-230280177 CGGGCTCTGGCCCCTTCTCCCGG - Exonic
923165507 1:231357280-231357302 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
923180338 1:231511675-231511697 CGGCCTATAGTTCCAGCTCCTGG - Intergenic
923874046 1:238028358-238028380 CGGCGTCTCGCTCTGTCACCAGG - Intergenic
924385049 1:243492324-243492346 CGGAGTCTTGCTCCGTCACCCGG + Intronic
924730412 1:246706207-246706229 CGGACTCTTGCTTTGTCTCCAGG - Intergenic
1063610129 10:7554678-7554700 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1063637563 10:7798429-7798451 CGGAGTCTAGCTCTGTCTCCCGG + Intronic
1063861158 10:10308779-10308801 TGGAGTCTAGCTCCGTCACCAGG - Intergenic
1064063665 10:12161713-12161735 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
1064951461 10:20855201-20855223 CGGACTCTCGCTCTGTCTCCAGG - Intronic
1065905363 10:30246249-30246271 CGGAGTCTAGCTCTGTCACCCGG + Intergenic
1066688550 10:38003987-38004009 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
1067004089 10:42644994-42645016 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
1068102996 10:52579981-52580003 CGGACTCTTGCTCTGTCACCAGG - Intergenic
1069190081 10:65476842-65476864 CGGAGTCTAGCTCTGTCGCCCGG + Intergenic
1069714499 10:70511999-70512021 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1070842336 10:79495795-79495817 CGGCGTCTCGCTCTGTCCCCAGG - Intergenic
1071473688 10:86006590-86006612 CGGCGTCTCGCTCTGTCGCCAGG - Intronic
1071573704 10:86711459-86711481 CTGCCTCCACCTCCCTCTCCGGG + Intronic
1072457575 10:95590136-95590158 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
1072942313 10:99777437-99777459 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
1073356043 10:102855182-102855204 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1074935140 10:118170751-118170773 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
1076541982 10:131220365-131220387 GGGCCTCTGGCTCTGTCTGCAGG + Intronic
1077043150 11:533326-533348 CTGGCTCTAGCTCCAGCTCCGGG - Intronic
1077305568 11:1867304-1867326 CGGCCTCTGGGTCTGTGTCCTGG - Intronic
1077413668 11:2414757-2414779 CCGCCTCGGCCTCCGTCTCCAGG + Exonic
1077627717 11:3787964-3787986 TGGACTCTGGCTCCGTCGCCAGG - Intronic
1078243807 11:9554672-9554694 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
1078379926 11:10830679-10830701 CGGAGTCTGGCTCTGTCTCCCGG - Intronic
1078782705 11:14454611-14454633 CGGACTCTGGCTCTGTCACCAGG - Intronic
1079194509 11:18313886-18313908 CGGAGTCTAGCTCTGTCACCAGG - Intronic
1079686660 11:23367355-23367377 CGGAATCTAGCTCTGTCGCCAGG - Intergenic
1080722675 11:34865347-34865369 GGGCCTCCAGATCTGTCTCCTGG + Intronic
1081940538 11:46937592-46937614 CGGAGTCTAGCTCTGTCGCCCGG + Intronic
1082034772 11:47636101-47636123 CGGACTCTTGCTCTGTCACCTGG - Intronic
1083171148 11:60924684-60924706 CGGCCCCTGGCTCTGCCTCCTGG + Exonic
1083381648 11:62274199-62274221 TGGCCTCTTTCTCCGTCTTCAGG + Intergenic
1083441911 11:62682356-62682378 CGGCCTCTTACTCTGTCACCAGG - Intergenic
1083795584 11:65014647-65014669 CGCCCTCGAGCTCCGAATCCCGG + Intronic
1084002503 11:66304551-66304573 CGGAGTCTTGCTCTGTCTCCCGG + Intergenic
1084402557 11:68953383-68953405 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1084408348 11:68991796-68991818 CGGAGTCTTGCTCCGTCACCAGG + Intergenic
1084707578 11:70824209-70824231 TTGGCTCTAGCTCTGTCTCCAGG - Intronic
1085060011 11:73437121-73437143 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1086597716 11:88593650-88593672 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1086723884 11:90157744-90157766 CAGAGTCTTGCTCCGTCTCCAGG + Intronic
1087484425 11:98744044-98744066 CGGAGTCTTGCTCCGTCCCCAGG + Intergenic
1089448709 11:118575002-118575024 CGGATTCTCGCTCTGTCTCCAGG + Intronic
1089728445 11:120503814-120503836 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
1091491997 12:940585-940607 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1091642725 12:2249881-2249903 CTGCCTCAAGCTCCGCCTCCCGG + Intronic
1091949245 12:4579246-4579268 CGGCATCTCGCTCTGTCACCAGG - Intronic
1092396293 12:8129762-8129784 CGGAATCTTGCTCCGTCGCCAGG - Intronic
1092461506 12:8690895-8690917 CGGACTCTCGCTCTGTCGCCAGG - Intronic
1093503734 12:19840159-19840181 CAGCCTCCATCTCCATCTCCCGG - Intergenic
1093583923 12:20814870-20814892 CGGAGTCTTGCTCTGTCTCCCGG - Intronic
1093940684 12:25050501-25050523 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1094609337 12:31978569-31978591 CGGGCTCTCGCTCTGTCGCCAGG + Intronic
1094643172 12:32296281-32296303 CGGAGTCTCGCTCCGTCACCAGG + Intronic
1095460145 12:42434716-42434738 CGGAGTCTTGCTCTGTCTCCTGG + Intronic
1096998612 12:55856778-55856800 CGGCATCTTGCTCTGTCACCAGG + Intergenic
1097552791 12:61097353-61097375 TCACCTCAAGCTCCGTCTCCCGG - Intergenic
1097647356 12:62252409-62252431 GGGCCTCTTGCTGTGTCTCCTGG + Intronic
1097777752 12:63668288-63668310 CCTCCTCTACCTCCGGCTCCCGG + Exonic
1100522692 12:95390642-95390664 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1101090663 12:101281728-101281750 TGGAGTCTCGCTCCGTCTCCAGG + Intronic
1101256457 12:102982381-102982403 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1102183369 12:110929542-110929564 CGGACTCTCGCTCTGTCGCCAGG - Intergenic
1103821840 12:123705186-123705208 CAGAGTCTTGCTCCGTCTCCAGG + Intronic
1104833531 12:131771677-131771699 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1104950569 12:132438022-132438044 CAGGCTCCAGCTCCGTCTCTGGG - Intergenic
1105015505 12:132784271-132784293 CAGCCTGCAGCTCCGCCTCCAGG + Exonic
1106172821 13:27303432-27303454 CGGAGTCTCACTCCGTCTCCAGG + Intergenic
1106820183 13:33455916-33455938 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
1107465525 13:40646617-40646639 CGGAGTCTGGCTCTGTCTCCAGG + Intronic
1107858429 13:44637942-44637964 TGGCATCTAGCTCTGTCACCAGG + Intergenic
1109150995 13:58847275-58847297 CGGAATCTAGCTCTGTCGCCAGG + Intergenic
1109573170 13:64218853-64218875 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
1109735791 13:66482934-66482956 GGGCCTCTAGCTATTTCTCCTGG + Intronic
1109974867 13:69818244-69818266 CGGAGTCTTGCTCCGTCACCAGG + Intronic
1111284295 13:86068003-86068025 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
1111563565 13:89984920-89984942 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1112270390 13:97963393-97963415 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1113855107 13:113439471-113439493 CGGCGTCTTGCTCTGTCGCCAGG + Intronic
1114258792 14:21023471-21023493 CTGCCCCCAGCTCCGTTTCCAGG + Intronic
1114482223 14:23042978-23043000 CCTCCTCTGGCTCCGGCTCCAGG - Exonic
1114609859 14:24032587-24032609 CGGCATCTTGCTCTGTCACCAGG - Intergenic
1114721613 14:24888695-24888717 CGGAGTCTAGCTCTGTCACCAGG - Intronic
1115771658 14:36668412-36668434 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1117186176 14:53243196-53243218 CAGAGTCTAGCTCTGTCTCCAGG + Intergenic
1117328712 14:54691733-54691755 GTGCCTCTAGCTCCCTCTACAGG + Intronic
1118206488 14:63728057-63728079 CGGCCTGTGGCGCCGTCACCCGG - Intergenic
1118847462 14:69558510-69558532 CGGCGTCTTGCTCCGTCGCCAGG + Intergenic
1119019519 14:71096290-71096312 CAGAGTCTAGCTCTGTCTCCAGG - Intronic
1119347129 14:73935035-73935057 CGGAGTCTTGCTCCGTCGCCAGG - Intronic
1119491983 14:75042798-75042820 CGGCGTCTCGCTCTGTCGCCCGG + Intronic
1120928875 14:89827264-89827286 CAGCCTCTAGCACCCTCTCCAGG - Intronic
1121050462 14:90816381-90816403 CGGGCTCGGGCTCCGGCTCCCGG + Exonic
1121162922 14:91761644-91761666 CGGAGTCTTGCTCCGTCGCCTGG - Intronic
1122629750 14:103102185-103102207 CGGCCACCAGCAGCGTCTCCAGG - Exonic
1122675262 14:103407584-103407606 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1124250310 15:28102623-28102645 CGGAGTCTTGCTCCGTCGCCAGG + Intergenic
1124262447 15:28204592-28204614 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1125705906 15:41735706-41735728 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
1125803183 15:42468715-42468737 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1125808689 15:42517733-42517755 TGGCCTCTCCCTCTGTCTCCCGG + Intronic
1125905996 15:43393233-43393255 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1126008322 15:44279523-44279545 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1126022663 15:44417946-44417968 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
1126761707 15:51975513-51975535 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1126993928 15:54417947-54417969 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1127786853 15:62363358-62363380 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1127938521 15:63668456-63668478 CAGCCTCTTGCTCTGTCACCCGG - Intronic
1128177597 15:65569681-65569703 CGGGGTCTCGCTCCGTCACCCGG - Intronic
1128312505 15:66640144-66640166 TGGGCTCTAGCTCCCTGTCCTGG - Intronic
1128656053 15:69462796-69462818 CGGCCTCCAGCCCCGCCTCTCGG - Intergenic
1128987556 15:72231822-72231844 CGGCCTCGCGCTCCCGCTCCAGG - Intronic
1129369598 15:75081767-75081789 CGGACTCTAACTCTGTCTCCAGG - Intronic
1130447275 15:84014969-84014991 CGGAGTCTTGCTCCGTCACCAGG + Intronic
1131690433 15:94821377-94821399 CGGAGTCTCGCTCCGTCGCCAGG + Intergenic
1132503559 16:295940-295962 CGGAGTCTAGCTCTGTCGCCCGG - Intronic
1132537838 16:492169-492191 CTGCCTCTAGTTCCATTTCCAGG + Intronic
1132648002 16:1007903-1007925 CGGCCCCTGGCCCCGTTTCCTGG + Intergenic
1132893138 16:2214372-2214394 CGGCCTCCAGCTCCGCGGCCAGG + Exonic
1134372642 16:13639479-13639501 TGGAGTCTAGCTCCGTCTCCAGG - Intergenic
1135751983 16:25065591-25065613 CGGAGTCTTGCTCTGTCTCCCGG + Intergenic
1135846610 16:25924646-25924668 CGACCTCTACCTGCCTCTCCTGG + Intronic
1135866978 16:26112405-26112427 CGGAATCTAGCTCTGTCACCTGG + Intronic
1136186315 16:28590827-28590849 AGGCCTCAGGGTCCGTCTCCGGG - Exonic
1137258959 16:46806281-46806303 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1138521295 16:57572664-57572686 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1139367025 16:66439747-66439769 TGGCCTCTAGCTCCTCCTCCAGG - Intronic
1139416151 16:66812541-66812563 CGGACTCTTGCTCTGTCTCCAGG + Intronic
1140032569 16:71350280-71350302 CGGGATCTAGCTCTGTCGCCAGG + Intergenic
1140869273 16:79091804-79091826 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1141704352 16:85656532-85656554 CGGCCAGCAGCTCCTTCTCCCGG - Exonic
1141780809 16:86159479-86159501 CGGACTCTCGCTCTGTCCCCAGG + Intergenic
1141854398 16:86671191-86671213 CGGCATCTCGCTCTGTCGCCAGG + Intergenic
1142636311 17:1259925-1259947 CGGAGTCTCGCTCGGTCTCCAGG - Intergenic
1142656867 17:1400174-1400196 CAGCCTCTCGCTCCGCGTCCGGG + Exonic
1142876219 17:2853454-2853476 CGGCCCCGAGCTCCCTCCCCAGG - Intronic
1143153218 17:4819672-4819694 CTGCCTCTACCTCTGGCTCCGGG - Intronic
1143626188 17:8111355-8111377 CCACCTCTAGCTCTGTCTGCAGG + Exonic
1143707843 17:8711958-8711980 CGGAGTCTGGCTCTGTCTCCAGG - Intergenic
1143817397 17:9528321-9528343 CGGACTCTCGCTCTGTCGCCAGG + Intronic
1143969999 17:10788643-10788665 CGGAGTCTCGCTCCGTCACCAGG + Intergenic
1144215792 17:13054129-13054151 CGGCACCTAGCTCTGTCGCCAGG + Intergenic
1144292313 17:13838220-13838242 CGGCGTCTCGCTCTGTCGCCAGG - Intergenic
1144391563 17:14798406-14798428 CGGAGTCTCGCTCCGTCACCAGG + Intergenic
1145882108 17:28359828-28359850 CAGCCTCTGCCTCCGCCTCCTGG - Intronic
1146023301 17:29297447-29297469 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
1146181816 17:30703296-30703318 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1146201460 17:30862307-30862329 CGGAGTCTTGCTCTGTCTCCTGG - Intronic
1147024034 17:37565236-37565258 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1148031678 17:44626146-44626168 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1148119481 17:45199678-45199700 CGGACTCTTGCTCTGTCGCCAGG + Intergenic
1148493888 17:48040456-48040478 CGGAGTCTTGCTCCGTCACCAGG + Intergenic
1148531665 17:48398993-48399015 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1149612095 17:57965263-57965285 CGGAGTCTTGCTCCGTCACCAGG - Intergenic
1149998288 17:61416420-61416442 AGCCCACTAGCTCCTTCTCCAGG + Intergenic
1150271140 17:63865939-63865961 CGGACTCTTGCTCTGTCCCCAGG - Intergenic
1151040172 17:70850411-70850433 CTGACTCTTGCTCTGTCTCCAGG + Intergenic
1151426830 17:74036151-74036173 CGGAGTCTAGCTCTGTCTCCAGG - Intergenic
1151600667 17:75104280-75104302 GGACCTCTAGCTCCTTCACCAGG + Intronic
1151654599 17:75490051-75490073 CGGAGTCTTGCTCCGTCGCCAGG - Intronic
1151905231 17:77043612-77043634 CGGAATCTAGCTCTGTCTCCAGG - Intergenic
1152577483 17:81149259-81149281 CAGCCTCCAGCCCCGTCACCAGG + Intronic
1152590713 17:81210542-81210564 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1152871562 17:82756503-82756525 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1154983319 18:21522446-21522468 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1155159953 18:23187410-23187432 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1156744224 18:40369808-40369830 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1156747569 18:40411204-40411226 CGGCGTCTCGCTCTGTCACCAGG + Intergenic
1157538980 18:48485621-48485643 CAGACTCTTGCTCTGTCTCCAGG - Intergenic
1159899450 18:74031010-74031032 CCACTTCAAGCTCCGTCTCCCGG - Intergenic
1160443624 18:78911663-78911685 AGGCCTCTAGCTCCAGCCCCAGG + Intergenic
1160443645 18:78911725-78911747 AGGCCTCTAGCTCCTGCCCCAGG + Intergenic
1160443672 18:78911806-78911828 CGGCCTCCAGCTCCCACCCCAGG + Intergenic
1160556522 18:79729159-79729181 AGGACTCTAGCTCGGCCTCCAGG - Intronic
1160564726 18:79779995-79780017 CGGCCTCTGGCTCCGGATTCTGG - Intergenic
1160755202 19:753409-753431 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1160806455 19:994245-994267 CGTCCTCCAGCTCCGTCACACGG - Exonic
1161018217 19:1993969-1993991 CGGATTCTCGCTCTGTCTCCAGG - Intronic
1161093316 19:2374546-2374568 CGGAGTCTCGCTCTGTCTCCAGG - Intergenic
1161148877 19:2696130-2696152 CGGAGTCTTGCTCTGTCTCCCGG - Intronic
1161935571 19:7369870-7369892 CGGCATCTCGCTCTGTCTCCTGG - Intronic
1162296828 19:9819296-9819318 TCGCCTCTAGCCCCGTCCCCGGG - Intronic
1162404789 19:10467267-10467289 CTGCCTCCAGCTCGGCCTCCAGG - Exonic
1162469864 19:10866224-10866246 CGGACTCTCGCTCTGTCACCAGG + Intronic
1162477425 19:10908930-10908952 CGGCTTCCTGCTCCCTCTCCTGG + Intronic
1162844229 19:13379896-13379918 CGGCATCTTGCTCTGTCACCAGG - Intronic
1162844279 19:13380256-13380278 CGGCATCTTGCTCTGTCACCAGG - Intronic
1162905010 19:13818079-13818101 CCGCCCCTAGCCCCGCCTCCTGG + Intronic
1163160971 19:15464034-15464056 GGGCCTCCTGCTCCGGCTCCGGG + Exonic
1163656447 19:18548364-18548386 TGGAGTCTAGCTCTGTCTCCAGG - Intergenic
1163897868 19:20075384-20075406 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
1164117025 19:22232191-22232213 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1164580826 19:29433867-29433889 CAGCCTCTTTCTCCTTCTCCAGG + Intergenic
1165104358 19:33460340-33460362 CCGCCTCGAGCTCCCTCTCCAGG - Intronic
1165129422 19:33622593-33622615 CGGACTCCCGCTCCGCCTCCTGG + Intronic
1165360247 19:35332052-35332074 CGGCCCCTGGCTCCTGCTCCTGG + Exonic
1165649232 19:37471037-37471059 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1165682624 19:37790598-37790620 GTACCTCTGGCTCCGTCTCCTGG + Intronic
1166053448 19:40274778-40274800 CTTCCTCTAGCTACATCTCCCGG - Intronic
1166414272 19:42581862-42581884 CGGAGTCTCGCTCCGTCGCCAGG - Intronic
1166551496 19:43668811-43668833 CGCCCTCTGGCTCCGCCTCGAGG + Intronic
1166580996 19:43899332-43899354 CGGAGTCTCGCTCCGTCACCAGG - Intronic
1166748864 19:45155290-45155312 CGGAATCTTGCTCTGTCTCCAGG - Intronic
1167357497 19:49012987-49013009 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1168476898 19:56682604-56682626 CGGCGTCTCGCTCTGTCGCCAGG - Intergenic
1168617170 19:57848006-57848028 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1168644342 19:58050544-58050566 CGGCGTCTCGCTCTGTCGCCAGG + Intronic
925236790 2:2285835-2285857 CATGCTCTAGCTCTGTCTCCAGG - Intronic
926135126 2:10331046-10331068 CCGCCTCTCGCTCCATCTCGTGG + Intronic
926268042 2:11344251-11344273 CTGCCTCTAGCTCCGGCTTCGGG + Exonic
927152024 2:20201733-20201755 CTGCCTGTGGCGCCGTCTCCAGG - Exonic
927977847 2:27353355-27353377 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
928703995 2:33927690-33927712 CGGCGTCTTGCTCTGTCGCCAGG - Intergenic
928708255 2:33975927-33975949 GGGAGTCTAGCTCTGTCTCCAGG + Intergenic
929006482 2:37398197-37398219 CGGAGTCTCGCTCCGTCCCCAGG - Intergenic
929595957 2:43176118-43176140 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
929952917 2:46429819-46429841 CACCCTCTACCTCTGTCTCCTGG - Intronic
930824959 2:55687412-55687434 TGGACTCTTGCTCCATCTCCAGG - Intronic
931030221 2:58167184-58167206 CGGAGTCTAGCTCTGTCACCAGG - Intronic
931595649 2:63939784-63939806 CGGAGTCTTGCTCCGTCACCAGG + Intronic
931636047 2:64341541-64341563 TGGCCTCTACTTCCTTCTCCAGG + Intergenic
932075613 2:68659860-68659882 CGGCGTCAAGCTCTGTCACCAGG - Intergenic
932170718 2:69553467-69553489 CGGAGTCTAGCTCTGTCACCAGG + Intronic
932202623 2:69845262-69845284 GGACCTCTGGCTCCATCTCCAGG - Intronic
932234019 2:70106719-70106741 CGGAGTCTAGGTCTGTCTCCAGG - Intergenic
932967033 2:76488670-76488692 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
933470473 2:82716689-82716711 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
933509199 2:83218531-83218553 CGGAGTCTAGCTCTGTCACCAGG + Intergenic
934013997 2:87858250-87858272 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
934509238 2:94923772-94923794 CGGCGTCTTGCTCTGTCACCAGG - Intergenic
935016843 2:99191030-99191052 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
935639710 2:105279281-105279303 CAGGGTCTAGCTCTGTCTCCAGG + Intronic
938087989 2:128414066-128414088 CGGCCTGTGGCTCAGACTCCAGG + Intergenic
938311001 2:130288057-130288079 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
938541987 2:132290711-132290733 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
939135520 2:138288857-138288879 CAGCCTCTCGCTCCGCGTCCAGG + Intergenic
940463923 2:154004229-154004251 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
941823359 2:169864880-169864902 CGGAGTCTCGCTCCGTCACCCGG - Intronic
943063368 2:183061521-183061543 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
943464580 2:188213369-188213391 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
944294953 2:198051758-198051780 CGGCGTCTTGCTCTGTCGCCAGG + Intronic
946428262 2:219611443-219611465 AGGCCACCAGCTCCCTCTCCCGG - Intronic
946542149 2:220696405-220696427 CAGAGTCTCGCTCCGTCTCCAGG - Intergenic
946619773 2:221548336-221548358 CGGACTCTCGCTCTGTCGCCAGG - Intronic
946819698 2:223617109-223617131 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
946938290 2:224744425-224744447 CGGATTCTAGCTCTGTCACCAGG - Intergenic
947499200 2:230659897-230659919 CGGAGTCTTGCTCCGTCACCAGG + Intergenic
947673451 2:231957430-231957452 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
948042590 2:234915114-234915136 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
948776758 2:240293211-240293233 AGGCCTCCAGCTCAGTCTGCCGG - Intergenic
1169089175 20:2847502-2847524 CGGACTCTTGCTCTGTCGCCAGG + Intronic
1169151250 20:3291367-3291389 CGGAGTCTCGCTCCGTCGCCAGG + Intronic
1169840913 20:9936291-9936313 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
1170207905 20:13819392-13819414 CGGAGTCTCGCTCTGTCTCCAGG + Exonic
1172117930 20:32583213-32583235 CGGCCTGCAGCCCCGTCCCCTGG + Intronic
1172311411 20:33921160-33921182 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1172406310 20:34692404-34692426 CGGGGTCTTGCTCTGTCTCCAGG + Intergenic
1172542990 20:35736674-35736696 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1173250687 20:41362841-41362863 GGCCCTCTGGCTCTGTCTCCTGG + Exonic
1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG + Intronic
1174743588 20:53040078-53040100 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1174965672 20:55211806-55211828 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1175218089 20:57401971-57401993 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1176131794 20:63499387-63499409 CCGGCTCTCGCCCCGTCTCCCGG - Intergenic
1177076163 21:16575862-16575884 CGGAGTCTAGCTCCGTCTCCAGG - Intergenic
1177923676 21:27186531-27186553 TGGCGTCTAGCTCTGTCACCAGG - Intergenic
1178568401 21:33710829-33710851 CGGAGTCTTGCTCCGTCGCCAGG + Intronic
1179391561 21:40996818-40996840 CGGACTCTTGCTCTGTCACCAGG - Intergenic
1179613927 21:42569648-42569670 CGGCCTCCAGGCCCCTCTCCCGG + Intronic
1181298994 22:21866360-21866382 CGGGGTCTCGCTCTGTCTCCAGG - Intronic
1181476703 22:23172626-23172648 CGGATTCTTGCTCCGCCTCCTGG - Intergenic
1181743768 22:24941694-24941716 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1182270314 22:29149186-29149208 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1182304356 22:29357710-29357732 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1182906017 22:33937099-33937121 CGGGATCTACCTCCGCCTCCTGG + Intergenic
1183240225 22:36652342-36652364 AGGTCTTTAGCTCGGTCTCCAGG + Intronic
1183289740 22:36993035-36993057 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1183798085 22:40137592-40137614 CTGCTTCTAACTCCATCTCCAGG - Intronic
1183983557 22:41556783-41556805 CGGACTCTTGCTCTGTCGCCAGG + Intergenic
1184857446 22:47154122-47154144 GGGCCTCCAGCACTGTCTCCAGG + Intronic
1185305601 22:50113941-50113963 CAGCGTCTTGCTCCGTCGCCCGG + Intronic
949443783 3:4111711-4111733 CGGTGTCTAGCTCTGTCGCCAGG - Intronic
949993386 3:9597999-9598021 CGGAGTCTCGCTCCGTCACCAGG + Intergenic
951874539 3:27407452-27407474 CGGAGTCTCGCTCCGTCACCAGG - Intronic
951960136 3:28308955-28308977 CGGAGTCTCGCTCCGTCGCCGGG - Intronic
952939620 3:38432539-38432561 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
953406834 3:42663953-42663975 CGGCACCGAGCTCCGTCCCCAGG - Intronic
953808015 3:46088585-46088607 CAACCTCTGCCTCCGTCTCCCGG + Intergenic
953908851 3:46882101-46882123 CGGCCTCTAGCGCAATGTCCCGG + Intronic
954412266 3:50375977-50375999 CATCCTCTAGCTCCGCATCCAGG + Exonic
954476645 3:50752481-50752503 CGGACTCTCGCTCTGTCGCCAGG - Intronic
954786304 3:53095235-53095257 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
954948879 3:54451266-54451288 CAGCCTCTTGCTCTGTCACCAGG + Intronic
955689860 3:61580404-61580426 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
956843606 3:73162194-73162216 CAGACTCTCGCTCTGTCTCCAGG + Intergenic
957185640 3:76938326-76938348 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
960719917 3:120616002-120616024 CGGCCTCTTCCTCAGTCTTCGGG + Intergenic
961432762 3:126894682-126894704 CAGCCTCCTGCTCCGTCTGCTGG - Intronic
962090670 3:132241176-132241198 CAGCTTCTACCTCCTTCTCCTGG + Intronic
962715216 3:138119729-138119751 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
963097686 3:141562696-141562718 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
963236672 3:142963369-142963391 CGACCTCTGGCGCCGGCTCCCGG + Exonic
963919014 3:150888080-150888102 CGGAATCTTGCTCCGGCTCCCGG - Intronic
965565478 3:170112234-170112256 CGGAATCTAGCTCTGTCGCCAGG + Intronic
965941897 3:174194421-174194443 CGGAGTCTAGCTCTGTCTCCAGG - Intronic
966180080 3:177180209-177180231 CGGAGTCTTGCTCCGTCACCAGG - Intronic
966230253 3:177643438-177643460 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
966337385 3:178883728-178883750 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
966821323 3:183927017-183927039 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
967001847 3:185343476-185343498 CGGCATCTCGCTCTGTCGCCAGG + Intronic
967493687 3:190120617-190120639 CGGGCTCCAGCTCCAGCTCCCGG + Exonic
967814218 3:193785782-193785804 CGGAGTCTCGCTCTGTCTCCGGG - Intergenic
967922840 3:194625504-194625526 CGGACTCTTGCTCTGTCGCCAGG + Intronic
967960045 3:194913067-194913089 CGGAGTCTCGCTCCGTCGCCAGG - Intergenic
968023396 3:195416318-195416340 CGGCGTCTTGCTCTGTCACCAGG - Intronic
968182219 3:196604243-196604265 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
968320603 3:197764682-197764704 CGGACTCTCGCTCTGTCACCCGG - Intronic
968450581 4:674279-674301 CGGCATCCTGCTCCGTCTGCAGG - Exonic
969052603 4:4384032-4384054 CGGAGTCTTGCTCCGTCGCCAGG - Intronic
969077594 4:4592583-4592605 CAGCCTCTTTCTCCCTCTCCTGG - Intergenic
969268970 4:6085980-6086002 TGGCTTCTCTCTCCGTCTCCAGG + Intronic
969394670 4:6912352-6912374 CGGAGTCTAGCTCTGTCACCAGG - Intronic
969650298 4:8462677-8462699 CGGAGTCTTGCTCCGTCACCAGG - Intronic
969745937 4:9071622-9071644 AGGTCTCTAGCTCCTTCTTCCGG - Intergenic
970861337 4:20706599-20706621 CGGAATCTCGCTCCGTCGCCAGG + Intronic
971472548 4:27042274-27042296 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
971965378 4:33548636-33548658 CGGATTCTCGCTCTGTCTCCAGG + Intergenic
972430436 4:38976263-38976285 CGGAGTCTAGCTCTGTCACCAGG - Intronic
972449197 4:39180265-39180287 CGAAGTCTAGCTCCGTCACCAGG + Intergenic
973169588 4:47122858-47122880 CTTCCTCTAGCTCCCTCTACTGG + Intronic
973325543 4:48857543-48857565 CGGAGTCTTGCTCCGTCGCCAGG + Intronic
974505314 4:62762107-62762129 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
974631357 4:64493104-64493126 CGGAGTCTCGCTCTGTCTCCCGG - Intergenic
974685249 4:65218601-65218623 CGGACTCTTGCTCTGTCACCAGG - Intergenic
974774964 4:66467551-66467573 CGGAGTCTCGCTCCATCTCCAGG + Intergenic
975237888 4:72021817-72021839 CGGACTCTCGCTCTGTCCCCAGG - Intergenic
975415479 4:74099424-74099446 CGGGCTCTCGCTCCCGCTCCAGG - Intergenic
975575587 4:75859434-75859456 CGATCTCAAGCTCCGCCTCCCGG + Intergenic
975583185 4:75925108-75925130 CAGCCTCCGGCTCCGCCTCCCGG + Intronic
975827408 4:78334394-78334416 CGGAGTCTTGCTCCGTCACCAGG + Intronic
976576397 4:86677338-86677360 CGGAGTCTAGCTCTGTCACCAGG + Intronic
976608053 4:87001240-87001262 CGGCGTCTCGCTCTGTCACCAGG + Intronic
977752594 4:100627207-100627229 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
980281057 4:130720459-130720481 TGGAGTCTTGCTCCGTCTCCAGG + Intergenic
981087210 4:140696429-140696451 CGGACTCTTGCTCTGTCTCCAGG - Intronic
981431720 4:144668724-144668746 CGGACTCTTGCTCTGTCACCAGG - Intronic
982650043 4:158077448-158077470 CGGCGTCTGGCTCTGTCTCCCGG + Intergenic
984614824 4:181885286-181885308 CGGAGTCTAGCTCCATCACCAGG + Intergenic
984679494 4:182590821-182590843 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
984923037 4:184782714-184782736 CTGCCCCTAGCTCCTTCTACAGG + Intronic
986289270 5:6385792-6385814 CGGAGTCTCGCTCTGTCTCCAGG - Intergenic
987049844 5:14140211-14140233 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
987362704 5:17121470-17121492 CCACCGCAAGCTCCGTCTCCCGG - Intronic
987964580 5:24855161-24855183 CAGCCTCTAGCTCCTATTCCAGG + Intergenic
988123588 5:26999211-26999233 CGGAGTCTCGCTCCGTCACCAGG - Intronic
988322143 5:29712729-29712751 CGGACTCTTGCTCTGTCACCAGG + Intergenic
988548641 5:32180363-32180385 CCGACTCTATCTCCGACTCCTGG + Intergenic
988661063 5:33269036-33269058 CGGAGTCTAGCTCCATCACCAGG - Intergenic
989075274 5:37558954-37558976 TGGAATCTAGCTCCGTCGCCTGG + Intronic
989604092 5:43227332-43227354 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
990002278 5:50908307-50908329 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
990561938 5:56992079-56992101 CGGCCTGAAGCTCCCTTTCCAGG + Intergenic
990578589 5:57147403-57147425 CGGCCTGAAGCTCCCTTTCCAGG - Intergenic
991218004 5:64178176-64178198 TGGAGTCTAGCTCCGTCACCAGG - Intronic
991721686 5:69499608-69499630 CGGAGTCTCGCTCCGTCGCCAGG + Intronic
992700098 5:79333268-79333290 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
993139604 5:84014617-84014639 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
993963281 5:94327978-94328000 CGGAGTCTAGCTCTGTCACCAGG - Intronic
994272102 5:97789939-97789961 CGGAGTCTAGCTCTGTCGCCAGG - Intergenic
995111307 5:108431793-108431815 CGGTTTCTTGCTCCCTCTCCAGG - Intergenic
996563007 5:124850867-124850889 CGGAGTCTCGCTCTGTCTCCAGG - Intergenic
996733424 5:126737386-126737408 CGGACTCTCGCTCTGTCTCCTGG - Intergenic
997904703 5:137804854-137804876 CGGCGTCTTGCTCTGTCGCCAGG - Intergenic
997912590 5:137890255-137890277 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
997982817 5:138479955-138479977 CGGAGTCTCGCTCTGTCTCCAGG - Intergenic
997999862 5:138616437-138616459 GGGCCTCTAGTTTCCTCTCCTGG + Intronic
998206507 5:140160971-140160993 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
999748639 5:154610289-154610311 CGGACTCTCGCTCTGTCGCCAGG - Intergenic
999832296 5:155332246-155332268 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1001193245 5:169649826-169649848 CGGCGTCTTGCTCTGTCACCCGG + Intronic
1001235769 5:170028045-170028067 GAGCCTCTAGATCCATCTCCAGG - Intronic
1002037562 5:176484046-176484068 CGGAGTCTAGCTCTGTCACCAGG - Intronic
1002377834 5:178801001-178801023 TGGACTCTTGCTCTGTCTCCAGG - Intergenic
1002563234 5:180096458-180096480 CGGCATCTTGCTCTGTCCCCAGG + Intergenic
1003164407 6:3663719-3663741 CTGCCTCTGGCACCCTCTCCAGG + Intergenic
1003177438 6:3762505-3762527 CGGAGTCTCGCTCTGTCTCCCGG + Intergenic
1003948818 6:11099198-11099220 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1004960631 6:20784185-20784207 CGGAGTCTAGCTCTATCTCCAGG - Intronic
1005023016 6:21435606-21435628 CGGAGTCTCGCTCTGTCTCCCGG + Intergenic
1005463536 6:26090819-26090841 AGGCCTGTTGCTCTGTCTCCAGG + Exonic
1005511546 6:26516376-26516398 CGGACTCTTGCTCTGTCGCCAGG - Intergenic
1005900877 6:30215155-30215177 CGGAGTCTCGCTCCGTCCCCAGG - Intergenic
1005951417 6:30634274-30634296 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1007408452 6:41648016-41648038 CGGAGTCTAGCTCCGTGCCCAGG - Intronic
1007489433 6:42207243-42207265 CGGCGTCTCGCTCTGTCGCCAGG + Exonic
1007500634 6:42294204-42294226 CGGAGTCTCGCTCTGTCTCCTGG + Intronic
1008749576 6:54716238-54716260 CGGAATCTTGCTCTGTCTCCAGG + Intergenic
1008760054 6:54843449-54843471 CGGAATCTCGCTCTGTCTCCAGG + Intergenic
1009688846 6:66999531-66999553 CGGAGTCTAGCTCTGTCACCCGG - Intergenic
1009827769 6:68889525-68889547 CGGCTTCTCGCTCTGTCCCCCGG + Intronic
1010132652 6:72512745-72512767 CGGCGTCTTGCTCTGTCGCCAGG - Intergenic
1010140948 6:72614047-72614069 CGGAGTCTCGCTCTGTCTCCTGG + Intergenic
1011458557 6:87578932-87578954 CAGTCTCTCGCTCTGTCTCCAGG - Intronic
1011601004 6:89060515-89060537 CGGAGTCTAGCTCTGTCACCTGG + Intergenic
1011959387 6:93068727-93068749 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1012323781 6:97887864-97887886 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1012470639 6:99569146-99569168 CGGAGTCTTGCTCTGTCTCCAGG + Intergenic
1012547554 6:100436762-100436784 TGGCCTCTTGCTCTGTCACCAGG + Intronic
1012558184 6:100542654-100542676 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1013061263 6:106636344-106636366 CGGAGTCTCGCTCTGTCTCCAGG + Intronic
1013109397 6:107053062-107053084 CGGACTCTTGCTCTGTCACCAGG + Intergenic
1014030106 6:116691201-116691223 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1014504634 6:122240177-122240199 CGGCATCTAGCTCTGTCTCCAGG + Intergenic
1015625260 6:135174980-135175002 CGGAGTCTAGCTCTGTCACCTGG - Intergenic
1015720070 6:136232278-136232300 CTGACTCTAGCTCTGTCGCCAGG + Intronic
1017016120 6:150100840-150100862 CGGCCTCTCTCTCGGTCTTCAGG - Intergenic
1018271800 6:162087617-162087639 CGGAGTCTCGCTCCGTCACCAGG + Intronic
1018435128 6:163752434-163752456 CGGCCTCTCTCTCCCTCACCAGG + Intergenic
1018739211 6:166714607-166714629 CCGCCTCTGCCTCTGTCTCCAGG - Intronic
1019724371 7:2593058-2593080 CGCACTCCAGCTCCTTCTCCAGG - Exonic
1020034956 7:4959145-4959167 CGGGCTCCGGCTCCGGCTCCGGG - Exonic
1020266102 7:6561090-6561112 CGGCATCTTGCTCTGTCTCCAGG - Intergenic
1020393403 7:7685333-7685355 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1020461402 7:8433691-8433713 CGGCCTCGAGCGCCGACGCCGGG - Intergenic
1020652249 7:10889827-10889849 CGGAGTCTTGCTCTGTCTCCCGG + Intergenic
1021279198 7:18696491-18696513 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1021608016 7:22428764-22428786 CGGACTCTCGCTCTGTCACCAGG - Intronic
1022331011 7:29378937-29378959 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1022704076 7:32786805-32786827 CAGAGTCTAGCTCTGTCTCCCGG - Intergenic
1023635134 7:42202054-42202076 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1023739934 7:43270470-43270492 CAGCTTCTACCTCAGTCTCCTGG - Intronic
1025151022 7:56549485-56549507 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
1026021047 7:66706433-66706455 CGGAGTCTCGCTCCGTCCCCAGG + Intronic
1026447790 7:70500673-70500695 TAGCCTCTAGCACCTTCTCCAGG + Intronic
1026566306 7:71492251-71492273 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1026821212 7:73550517-73550539 CGGACTCTCGCTCTGTCGCCAGG - Intronic
1026957863 7:74389167-74389189 CGGTCTCCAGCTCTGCCTCCAGG - Exonic
1027215043 7:76178293-76178315 CAGCCTCTGGCTCCCTCTGCAGG - Intergenic
1027385870 7:77659378-77659400 CGGACTCTTGCTCTGTCGCCTGG + Intergenic
1027551463 7:79602397-79602419 CGGAGTCTCGCTCTGTCTCCCGG + Intergenic
1027736439 7:81938219-81938241 CGGAGTCTCGCTCCGTCGCCCGG - Intergenic
1028156406 7:87434720-87434742 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1028373434 7:90119636-90119658 CCTCCTCTACCTCCGGCTCCGGG - Intergenic
1029290796 7:99500724-99500746 CGGACTCTCGCTCTGTCGCCAGG + Intronic
1029339425 7:99931087-99931109 CGGACTCTCGCTCTGTCACCAGG + Intergenic
1029341747 7:99950612-99950634 CGGAGTCTAGCTCTGTCACCCGG - Intergenic
1031802805 7:126270140-126270162 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
1032117830 7:129132043-129132065 CAGAGTCTAGCTCTGTCTCCAGG + Intergenic
1032235669 7:130119817-130119839 CGGAGTCTTGCTCTGTCTCCCGG - Intronic
1032354366 7:131195922-131195944 TGGAGTCTAGCTCTGTCTCCAGG - Intronic
1034189784 7:149205100-149205122 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1034327367 7:150248633-150248655 CGGAGTCTAGCTCTATCTCCAGG - Intronic
1034451298 7:151138585-151138607 GGGCCTCTAGCGCCGGCCCCAGG - Intronic
1034525529 7:151658130-151658152 CGGACTCTTGCTCTGTCACCAGG - Intronic
1034666775 7:152825334-152825356 CGGACTCTTGCTCTGTCACCCGG + Intronic
1034765841 7:153720816-153720838 CGGAGTCTAGCTCTATCTCCAGG + Intergenic
1035875144 8:3180658-3180680 CGGCATCTCGCTCTGTCACCCGG + Intronic
1036507685 8:9370218-9370240 CGATCTCAAGCTCCGCCTCCCGG - Intergenic
1036602619 8:10276050-10276072 AGGCCTCTCGCTCCGTGTCTGGG + Intronic
1037405604 8:18539571-18539593 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1038035430 8:23682709-23682731 CTGGCTCTGGCTCCGGCTCCGGG + Exonic
1038970246 8:32625817-32625839 CGGAGTCTAGCTCCGTCGTCAGG + Intronic
1039210381 8:35206374-35206396 CGGACTCTGGCTCTGTCGCCCGG + Intergenic
1039271886 8:35891343-35891365 CGACATCTTGCTCTGTCTCCAGG + Intergenic
1039908086 8:41800749-41800771 CGGCATCTCGCTCTGTCACCAGG + Intronic
1040532400 8:48276432-48276454 TGGCCTCTAACTCAGTCTCTGGG - Intergenic
1041799749 8:61786266-61786288 TGGCCACTAGCTCTCTCTCCAGG - Intergenic
1041916425 8:63144102-63144124 CGGCCTCTCTCTCAGTCTTCAGG + Intergenic
1042918121 8:73895035-73895057 CGGCAGCAAGCTCCGCCTCCCGG - Intergenic
1043224785 8:77711911-77711933 CGGCATCTCGCTCCTTCACCAGG - Intergenic
1043969185 8:86511446-86511468 CGGAGTCTAGCTCTGTCACCAGG - Intronic
1045575968 8:103419981-103420003 CGGAGTCTTGCTCCGTCACCAGG - Intronic
1046885385 8:119361393-119361415 CGGCGTCTCACTCTGTCTCCCGG + Intergenic
1047074862 8:121389908-121389930 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
1047153571 8:122292769-122292791 CGGACTCTTGCTCTGTCACCAGG - Intergenic
1047625428 8:126651502-126651524 TGGAGTCTAGCTCTGTCTCCAGG + Intergenic
1048272644 8:133041811-133041833 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1049628717 8:143639296-143639318 CAGCCTCCACCTCCGCCTCCTGG + Intronic
1049690551 8:143957076-143957098 CCGGCTGTAGCCCCGTCTCCAGG - Intronic
1049695484 8:143982447-143982469 CGGCATCTCGCTGTGTCTCCTGG - Intronic
1050175730 9:2867797-2867819 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1050610021 9:7342405-7342427 CTGCCTCCAGCTCCCTCTTCTGG - Intergenic
1052318735 9:27144254-27144276 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1052357687 9:27522214-27522236 CGGGGTCTTGCTCTGTCTCCAGG - Intronic
1052360316 9:27548868-27548890 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1053892351 9:42706577-42706599 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1054895197 9:70302465-70302487 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
1055483230 9:76730875-76730897 CGGAGTCTAGCTCTGTCGCCAGG - Intronic
1055538443 9:77274400-77274422 CGGACTCTCGCTCTGTCACCAGG - Intronic
1056182584 9:84100254-84100276 CGGAGTCTAGCTCTGTCACCAGG - Intergenic
1057105181 9:92408209-92408231 CGGAGTCTTGCTCTGTCTCCAGG + Intronic
1057337188 9:94165627-94165649 CGGTCTCTCGCTCTTTCTCCAGG - Intergenic
1057387348 9:94615850-94615872 CGGAGTCTAGCTCTGTCACCCGG + Intronic
1058059659 9:100481805-100481827 CGGAGTCTAGCTCTGTCACCGGG + Intronic
1058691432 9:107523799-107523821 CTGCCGCTACCTCCTTCTCCAGG - Intergenic
1059455272 9:114396651-114396673 TGGAGTCTAGCTCTGTCTCCAGG - Intergenic
1059634716 9:116159632-116159654 CGGCCTCTTGCTCCTTCCCCAGG + Intronic
1060329322 9:122650998-122651020 CGGCGTCTCGCTCTGTCACCTGG - Intergenic
1060564879 9:124581564-124581586 CGGAGTCTTGCTCTGTCTCCAGG - Intronic
1061125600 9:128673528-128673550 CGGAGTCTAGCTCTGTCACCCGG + Intergenic
1061488312 9:130931481-130931503 CGGAGTCTAGCTCTGTCTCCAGG - Intronic
1061622864 9:131823244-131823266 CGCCCCCCAGCTCCATCTCCTGG - Intergenic
1185621476 X:1453387-1453409 CCGCCCCCAGCTCCGCCTCCCGG + Intronic
1187017738 X:15346903-15346925 CGGAGTCTCGCTCTGTCTCCAGG - Intronic
1187435171 X:19261269-19261291 CGGAGTCTTGCTCCGTCGCCAGG + Intergenic
1187727563 X:22219642-22219664 CGGAGTCTAGCTCTGTCGCCAGG + Intronic
1187847405 X:23554957-23554979 CGGAGTCTCGCTCCGTCGCCAGG - Intergenic
1187872310 X:23774849-23774871 CGAACTCTCGCTCTGTCTCCAGG + Intergenic
1187874844 X:23795680-23795702 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
1188206239 X:27362968-27362990 CGGAGTCTCGCTCTGTCTCCAGG + Intergenic
1188617243 X:32173396-32173418 CGGAGTCTAGCTCTGTCACCAGG + Intronic
1190078387 X:47335851-47335873 CAGGGTCTAGCTCTGTCTCCAGG + Intergenic
1190276919 X:48904838-48904860 CTGCCTCTGCCTCCGCCTCCGGG - Exonic
1192281956 X:69697248-69697270 CGGCCTCTCTCTCAGTCTTCAGG + Intronic
1192282967 X:69703657-69703679 CGGCCTCTCTCTCGGTCTTCAGG + Intronic
1194167969 X:90544805-90544827 CGGCATCTTGCTCTGTCACCAGG - Intergenic
1194392378 X:93336014-93336036 ATGCCTCTAGCTCCTTCACCAGG + Intergenic
1194452704 X:94063878-94063900 CGGAGTCTTGCTCTGTCTCCAGG - Intergenic
1195862567 X:109397265-109397287 TGGCCCCTAGCTACCTCTCCAGG - Intronic
1196999263 X:121420668-121420690 CAAGCTCAAGCTCCGTCTCCTGG + Intergenic
1199005483 X:142691570-142691592 CGGAGTCTTGCTCCGTCACCAGG - Intergenic
1199130477 X:144180222-144180244 CGGAGTCTAGCTCTGTCGCCAGG + Intergenic
1199592885 X:149484340-149484362 CGGGGTCTAGCCCTGTCTCCAGG + Intronic
1200225731 X:154416320-154416342 CTGCCTCAAGCTCCGCCTCCCGG - Intronic
1200514221 Y:4122597-4122619 CGGCATCTTGCTCTGTCACCAGG - Intergenic