ID: 1173828129

View in Genome Browser
Species Human (GRCh38)
Location 20:46060321-46060343
Sequence TCATCTCCTAAGAGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173828125_1173828129 0 Left 1173828125 20:46060298-46060320 CCCTGGCCTGGAGAGCAGCACTA No data
Right 1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG No data
1173828124_1173828129 6 Left 1173828124 20:46060292-46060314 CCAGGGCCCTGGCCTGGAGAGCA No data
Right 1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG No data
1173828122_1173828129 15 Left 1173828122 20:46060283-46060305 CCGATAGCTCCAGGGCCCTGGCC No data
Right 1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG No data
1173828120_1173828129 18 Left 1173828120 20:46060280-46060302 CCACCGATAGCTCCAGGGCCCTG No data
Right 1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG No data
1173828126_1173828129 -1 Left 1173828126 20:46060299-46060321 CCTGGCCTGGAGAGCAGCACTAT No data
Right 1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG No data
1173828127_1173828129 -6 Left 1173828127 20:46060304-46060326 CCTGGAGAGCAGCACTATCATCT No data
Right 1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173828129 Original CRISPR TCATCTCCTAAGAGACTGGC AGG Intergenic
No off target data available for this crispr