ID: 1173830045

View in Genome Browser
Species Human (GRCh38)
Location 20:46077230-46077252
Sequence ACATACAGACAGCACTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173830045_1173830049 -9 Left 1173830045 20:46077230-46077252 CCTCTCCAGTGCTGTCTGTATGT 0: 1
1: 0
2: 2
3: 21
4: 226
Right 1173830049 20:46077244-46077266 TCTGTATGTTTGTTTGTGCGGGG 0: 1
1: 0
2: 2
3: 80
4: 1289
1173830045_1173830048 -10 Left 1173830045 20:46077230-46077252 CCTCTCCAGTGCTGTCTGTATGT 0: 1
1: 0
2: 2
3: 21
4: 226
Right 1173830048 20:46077243-46077265 GTCTGTATGTTTGTTTGTGCGGG 0: 1
1: 0
2: 8
3: 210
4: 2763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173830045 Original CRISPR ACATACAGACAGCACTGGAG AGG (reversed) Intronic
900807330 1:4776105-4776127 ACAGACCCACAGAACTGGAGAGG + Intronic
902469481 1:16638542-16638564 ACAGACAGAAAGCTCTGGAAGGG + Intergenic
903406211 1:23098739-23098761 AAAAACAGCCACCACTGGAGAGG + Intronic
904540259 1:31227948-31227970 TCTAACAGCCAGCACTGGAGTGG - Intronic
904855704 1:33496831-33496853 ACATACAGAAAGCCCTGGGCAGG - Intergenic
905711103 1:40104036-40104058 TCATCCAGACAGCAATGCAGTGG - Intergenic
906207710 1:43996002-43996024 GCAGGCAGGCAGCACTGGAGAGG - Exonic
906561628 1:46762405-46762427 ACAGAGAGAAAGCACAGGAGAGG - Intronic
906637274 1:47417553-47417575 ACCCACAGACAGCGCTGGGGTGG - Exonic
906781308 1:48575480-48575502 ACCTCCAGGCAGCACTGGTGTGG + Intronic
907654868 1:56332296-56332318 ACAGACAGACAGGTCTGGAGAGG - Intergenic
908739646 1:67313950-67313972 ATATACAGACAACACTTCAGAGG - Intronic
909283183 1:73783658-73783680 ACATACACAAAGCAGAGGAGAGG + Intergenic
910655746 1:89616203-89616225 ACAAACAGACAGTAATGCAGGGG + Intergenic
911748922 1:101472936-101472958 AGATCCAGACCCCACTGGAGAGG - Intergenic
913072455 1:115312509-115312531 ACATACTGTCAGCAATGGAGGGG + Intronic
915695984 1:157742135-157742157 ACCTACAGCCATCACTGGACAGG - Intergenic
915696135 1:157744041-157744063 ACCTACAGCCATCACTGGACAGG + Intergenic
919960987 1:202468539-202468561 ACAAAGAGATAGCTCTGGAGAGG - Intronic
921404587 1:214765036-214765058 ATGCACAGACAGTACTGGAGGGG + Intergenic
921598172 1:217077635-217077657 CCAAACAGACAGCACTGGGTAGG + Intronic
922362766 1:224838312-224838334 ATATATAGACAGAACTTGAGTGG - Intergenic
923275378 1:232390826-232390848 ACATCCAGAGAGCACTTCAGTGG + Intergenic
1063771916 10:9213766-9213788 AGATCCAGACCTCACTGGAGAGG + Intergenic
1063802970 10:9602628-9602650 ACATACAGAAGTCACTGAAGAGG + Intergenic
1064362859 10:14681375-14681397 ACACCCAGACAGCAATGGACAGG - Intronic
1064369746 10:14741064-14741086 ACAAGCAGACAGCACTGGGATGG + Intronic
1064498677 10:15944063-15944085 CCATCCAGACAGCACTGAAAGGG + Intergenic
1066005218 10:31140750-31140772 GCATACAGAAAGCACAGAAGTGG + Intergenic
1066576745 10:36834167-36834189 ACATACAGACAGGCCGGGCGCGG + Intergenic
1068952484 10:62791067-62791089 AAGTACGGACAGCACTGCAGAGG - Intergenic
1070787695 10:79171471-79171493 AGATAGAGAGAGCAGTGGAGAGG - Intronic
1070813586 10:79310457-79310479 ACAGACAGACAGCATTGGGCGGG - Intronic
1072100762 10:92227096-92227118 ACAAACACACAGCACTCTAGAGG - Intronic
1078723702 11:13908474-13908496 ACACACAAAAACCACTGGAGTGG + Intergenic
1079994125 11:27277290-27277312 ACAAACAAACAACACTGGAGAGG + Intergenic
1081753246 11:45527237-45527259 AGATGCAGACAGCACTGGAGTGG - Intergenic
1083431268 11:62614646-62614668 ACCTGCAAACAGCACTGGAGGGG + Exonic
1084421936 11:69064566-69064588 ACAAACACATAGCACTGGAGCGG - Intronic
1084590182 11:70085775-70085797 CCAAACAGTCAGCACTGCAGTGG - Intronic
1084845995 11:71900345-71900367 ACATACCCACAGCTGTGGAGGGG + Intronic
1086606217 11:88699640-88699662 AAATAGAGACAACTCTGGAGGGG + Intronic
1087649884 11:100852793-100852815 ACATAGGAACATCACTGGAGTGG + Intronic
1089035367 11:115384190-115384212 ACATCCATAAAGCACTGAAGGGG - Intronic
1092028315 12:5261796-5261818 ACAAAGAGAGATCACTGGAGAGG + Intergenic
1092051434 12:5473551-5473573 ACATACTATCAGCACTGGATTGG - Intronic
1093497900 12:19779091-19779113 ACATGCAGCCAGCACTCAAGTGG - Intergenic
1097046056 12:56188910-56188932 ACATACACAAAGCACCGGAGAGG + Intronic
1099918426 12:88925890-88925912 AAATAGAGAGATCACTGGAGAGG - Intergenic
1104130139 12:125885680-125885702 ACAAACCTACAGCACTGGCGGGG - Intergenic
1104565102 12:129873771-129873793 ACACACAGAGAGAACTAGAGAGG + Intronic
1107225817 13:38045832-38045854 ACCTTAAGCCAGCACTGGAGTGG + Intergenic
1107560121 13:41550868-41550890 ACCTAAAGACAGCAATGGAGAGG + Intergenic
1110158709 13:72350509-72350531 AGAGGGAGACAGCACTGGAGTGG + Intergenic
1110971520 13:81768380-81768402 TCATTCACACAGCAGTGGAGAGG + Intergenic
1111267787 13:85841645-85841667 AGTTTCAGACAGCCCTGGAGTGG - Intergenic
1111690622 13:91558809-91558831 AGATCCAGACCTCACTGGAGAGG - Intronic
1111971539 13:94922146-94922168 ACGTAAAGTCAGCACTGCAGAGG - Intergenic
1113207052 13:107929319-107929341 ACCAACAGAGAGCACGGGAGAGG + Intergenic
1113718551 13:112533453-112533475 ACAGACAGACAGCACAGCAGGGG + Intronic
1114319113 14:21532274-21532296 ACATACAGAAAGCAGAGTAGAGG + Intronic
1114548441 14:23519740-23519762 ACATGCAGACAGAATGGGAGGGG - Intergenic
1114588576 14:23837838-23837860 ATATAGAGAGAGCTCTGGAGGGG + Intergenic
1118193360 14:63601390-63601412 ACATACAGCCCACCCTGGAGAGG - Intronic
1120916376 14:89714048-89714070 AAATATAGACAGCTCTTGAGAGG - Intergenic
1122942731 14:104989656-104989678 AAAGACAGACAGCGCTCGAGTGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127407895 15:58671901-58671923 ACAGAAATAAAGCACTGGAGTGG + Intronic
1128869159 15:71139284-71139306 CCATTCCCACAGCACTGGAGAGG + Intronic
1129576031 15:76747161-76747183 ACATACAGACTGCAATGGTTTGG + Intronic
1129784318 15:78299168-78299190 AGATACAGACATCACTGGACGGG - Intronic
1130744508 15:86636427-86636449 ACATACAGAGAAGACAGGAGAGG + Intronic
1131512742 15:93058319-93058341 ACAGTCACACAGCTCTGGAGTGG - Intronic
1131811093 15:96173848-96173870 TAATACAAACAGCACTGGACTGG + Intergenic
1132037878 15:98501704-98501726 ACCTACAGACATCACTGCTGGGG - Intronic
1135304523 16:21356609-21356631 AGACAGAGATAGCACTGGAGTGG - Intergenic
1136301266 16:29335739-29335761 AGACAGAGATAGCACTGGAGTGG - Intergenic
1136395328 16:29989378-29989400 ACAGACAGACAGACATGGAGAGG - Intronic
1137868237 16:51923614-51923636 ACTTCCAGGCAGCACTGGACTGG - Intergenic
1140879342 16:79183569-79183591 ATTTACTCACAGCACTGGAGAGG - Intronic
1140883997 16:79226924-79226946 ACATACTGACAGAAATGGAATGG + Intergenic
1142062965 16:88042475-88042497 AGACAGAGATAGCACTGGAGTGG - Intronic
1142343990 16:89542295-89542317 CCTTCCAGACAGCTCTGGAGGGG + Intronic
1143098962 17:4494419-4494441 ACAAACAAACAAAACTGGAGGGG + Intergenic
1144953224 17:19004872-19004894 ACAGACAGACAGACCTGGGGCGG + Intronic
1145055355 17:19700066-19700088 ACAGACAGAAAGCAATGCAGTGG + Intronic
1145100084 17:20067893-20067915 ACAAACAGAAAGTACTTGAGTGG - Intronic
1149865102 17:60147203-60147225 ACATTGAGTTAGCACTGGAGAGG - Intergenic
1152403446 17:80083123-80083145 ACAAACAGCCAGGAGTGGAGCGG + Intronic
1153580254 18:6565877-6565899 ACACACAAAAAGCACTGGACTGG - Intronic
1155298107 18:24403846-24403868 ACCACCAGACAGCAGTGGAGAGG - Intergenic
1156416153 18:36893212-36893234 TCATACATACGGGACTGGAGTGG - Intronic
1157905534 18:51566494-51566516 ATAAACAGACAGGACTGCAGCGG - Intergenic
1158215750 18:55098925-55098947 ACATACAGACAACACTGTGCTGG + Intergenic
1160994180 19:1874346-1874368 CCATAAAGACAGCACTTCAGTGG + Intergenic
1161664448 19:5566547-5566569 ACACACAGACAGAACTGGACAGG + Intergenic
1162378041 19:10316567-10316589 ACAGACAGACAGCAGGGGACTGG + Exonic
1162489664 19:10984611-10984633 ACATGCAGAAAGCAAGGGAGCGG - Intronic
1163104456 19:15115479-15115501 ACATGCAGCCAGCCCAGGAGAGG + Intronic
1163500977 19:17675968-17675990 ACAGACAGACAACACGGGACAGG + Intronic
1164694668 19:30234347-30234369 AAATAGAGTCAGCAGTGGAGAGG - Intronic
1164798179 19:31053426-31053448 ATCTACAGCCAGCACTGAAGTGG - Intergenic
1166294520 19:41882663-41882685 AGATACAGAGAGAGCTGGAGAGG + Intergenic
1167609732 19:50501352-50501374 AAAGCCAGACAGCACCGGAGGGG - Intergenic
1168715956 19:58527519-58527541 ACAAAGTGACAGGACTGGAGAGG - Intronic
925452395 2:3980755-3980777 ACACATGGAAAGCACTGGAGAGG - Intergenic
926631728 2:15142707-15142729 ATAGACAGAGAGCACTTGAGAGG - Intergenic
928215177 2:29355341-29355363 ACATAAAAACAGCACTGGAGTGG - Intronic
929765002 2:44837089-44837111 ACAGACAGAAAGCACTGAATTGG + Intergenic
930892197 2:56403487-56403509 ACATACATGCAGGAGTGGAGTGG - Intergenic
931832745 2:66069511-66069533 TAGTACAGACAGCAGTGGAGGGG - Intergenic
932309469 2:70728197-70728219 CCAGACAGAGAGCACTGCAGTGG - Intronic
933545263 2:83702707-83702729 ACATACAAACACCACTGAAAGGG + Intergenic
934136191 2:88998566-88998588 ACATAGAGACAGAACTGGAATGG - Intergenic
934139756 2:89035113-89035135 ACATAAAGACAGAACTGCAATGG - Intergenic
934145790 2:89092836-89092858 ACATAGAGGCAGAACTGGAATGG - Intergenic
934223470 2:90107732-90107754 ACATAGAGGCAGAACTGGAATGG + Intergenic
934229488 2:90165438-90165460 ACATAAAGACAGAACTGCAATGG + Intergenic
934561861 2:95317672-95317694 ACAGACAGACAGACCAGGAGTGG + Intronic
934810611 2:97273438-97273460 ACCTACAGCCAGCACTCAAGGGG + Intergenic
934827081 2:97434501-97434523 ACCTACAGCCAGCACTCAAGGGG - Intergenic
934871268 2:97868532-97868554 GCCCACAGACTGCACTGGAGAGG + Intronic
936908307 2:117563146-117563168 AGATACAGACATCACTGCTGAGG - Intergenic
938052844 2:128190881-128190903 ACATGAAGACAGAACTGGTGTGG - Exonic
939267435 2:139891765-139891787 ACCTACAGCCTGCACTGTAGGGG - Intergenic
939606080 2:144255889-144255911 ACAAACACACACCACTGGGGTGG + Intronic
940937479 2:159513809-159513831 AAATACTGAAAGCCCTGGAGTGG + Intronic
943153895 2:184149119-184149141 ACATTCAGACCACACTGAAGGGG + Intergenic
945317077 2:208380823-208380845 ACTGACAGTCAGTACTGGAGTGG - Intronic
945478812 2:210320513-210320535 ACTTACAGACAGCTCAGGGGAGG - Intergenic
946024689 2:216664759-216664781 ACATTCAGATAACACTGCAGTGG + Intergenic
946502486 2:220264260-220264282 GGATGCAGACAGAACTGGAGTGG - Intergenic
946536638 2:220636764-220636786 ACTTTCAGACAACTCTGGAGTGG + Intergenic
946676640 2:222167532-222167554 ACAAAGACACAGCACTGGAAGGG + Intergenic
947124298 2:226851211-226851233 ACACACAGAGAGAAATGGAGAGG - Intronic
947735888 2:232455208-232455230 ACATAGAGACAGAAGTGGAATGG - Intergenic
948072969 2:235142386-235142408 ACATGTAGAGAGCACTGGATGGG - Intergenic
948216256 2:236235638-236235660 ACATGCAGACATCGCTGGTGCGG + Intronic
1168777235 20:457990-458012 ACAAATTGACAGCACTTGAGTGG + Intronic
1170122909 20:12929325-12929347 GCATTCAGACATGACTGGAGTGG + Intergenic
1171101181 20:22385058-22385080 ACCAACAGACAGCACAGGACTGG + Intergenic
1173830045 20:46077230-46077252 ACATACAGACAGCACTGGAGAGG - Intronic
1178637781 21:34320027-34320049 ACAAACATACAGCACTGGGTGGG - Intergenic
1180005787 21:45019807-45019829 CCATGCAGACACCTCTGGAGAGG - Intergenic
1181034942 22:20165381-20165403 GCACACAGACAGGCCTGGAGAGG - Intergenic
1181508878 22:23379978-23380000 GCACACAGACAGGCCTGGAGAGG + Intergenic
1182006031 22:26960384-26960406 TCATACAGAGAGCTCTGGAGTGG + Intergenic
1184264180 22:43338064-43338086 ACAGACAGACACCCCTGGATGGG - Intronic
1185039278 22:48496160-48496182 ACACACGCACAGCACTGGAGAGG - Intronic
1203303165 22_KI270736v1_random:91309-91331 AAATACAGAAAGAAGTGGAGTGG + Intergenic
950501994 3:13370434-13370456 TCATACAGCCAGCAAGGGAGTGG + Intronic
950869373 3:16215567-16215589 AAATTCAGACAGAACTGTAGAGG - Intronic
952161340 3:30696468-30696490 AGATGCAGTTAGCACTGGAGAGG + Intergenic
952401667 3:32969025-32969047 ACATCCACACAGCAATGAAGGGG - Intergenic
954208266 3:49076810-49076832 ATACACAGACAGCACTGAAGTGG - Exonic
954299956 3:49695670-49695692 ACAGACAGAAAGCTCTGGAAGGG - Intronic
954832159 3:53430738-53430760 ACAGACAGACCCCACTGGAAAGG - Intergenic
955628495 3:60946763-60946785 AAAAACAGACACCCCTGGAGAGG + Intronic
955930194 3:64048564-64048586 AATTACAGACATCACTGGAAAGG + Intergenic
957572648 3:81968118-81968140 ACAGATAGAAAGCACTGTAGTGG - Intergenic
958444671 3:94200822-94200844 ACCCACTGACAGCACTAGAGAGG - Intergenic
959348588 3:105231671-105231693 ACATACAGCCATCATTGGGGAGG + Intergenic
960236830 3:115292914-115292936 ACATTCAGACAGCAATCCAGTGG + Intergenic
964384139 3:156129285-156129307 ACATAGAGACAGAACTAGAAAGG - Intronic
964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG + Intronic
965381122 3:167989949-167989971 AGATAGAGACAGAACTGGAATGG - Intergenic
966471229 3:180291430-180291452 ACATAAAGACAGCCCTGGCTGGG - Intergenic
967235124 3:187376722-187376744 ACATAGTGCCAGTACTGGAGTGG + Intergenic
971526544 4:27625903-27625925 ACATACATACAGGCCTGGCGCGG - Intergenic
971628703 4:28960064-28960086 ACATATAGAGATCAATGGAGTGG - Intergenic
973743843 4:53944534-53944556 ACAGACATACAGCCCTGCAGTGG - Intronic
974632246 4:64508160-64508182 ACAGACAGAAAGTACAGGAGAGG + Intergenic
974976797 4:68902961-68902983 ACATCCACACAGCATTGAAGGGG + Intergenic
976536204 4:86221107-86221129 ACAGACAGACAGCCAAGGAGAGG + Intronic
977971623 4:103219239-103219261 ATCTACAGCCAGCACTGAAGTGG + Intergenic
984641877 4:182175580-182175602 AGATACCGACAGCACAGGACAGG + Intronic
984846969 4:184116232-184116254 ACAAACAAACAGCCCTGGTGAGG + Intronic
990682042 5:58255787-58255809 AAAAACAGAAAACACTGGAGAGG - Intergenic
991626237 5:68603941-68603963 ACACACAGACTGCACTTCAGTGG + Intergenic
993351185 5:86852854-86852876 ATCTACAGCCAGCACTGAAGGGG - Intergenic
993423724 5:87735650-87735672 ACAAACAGGAAGCACAGGAGTGG - Intergenic
995270894 5:110219158-110219180 AACTACAGCCAGCACTGAAGTGG - Intergenic
995428741 5:112050987-112051009 ATCTACAGCCAGCACTCGAGGGG + Intergenic
997245259 5:132342762-132342784 ACATACAGAGAGGTCTGGAAGGG + Intronic
998484369 5:142488766-142488788 ACATACATACAGCAGGGGTGAGG - Intergenic
998543698 5:143007300-143007322 ACATACAGAGAGAACTGGCCAGG - Intronic
1000698722 5:164421817-164421839 ACCTGCAGCCAGCACTTGAGTGG - Intergenic
1001296288 5:170501644-170501666 CCATAAGGACAGCACTTGAGAGG - Intronic
1002529211 5:179833884-179833906 ACCTACAGACAGCCCTGCAGTGG - Intronic
1002586187 5:180250130-180250152 ACACAGAGTCAGCACTGGGGAGG - Intronic
1003364657 6:5460955-5460977 ACACACACACAGCCCTGGTGTGG - Intronic
1004877673 6:19971935-19971957 ACAGACATATAGAACTGGAGGGG + Intergenic
1006609179 6:35282990-35283012 CCATGGAGACTGCACTGGAGGGG - Intronic
1007068290 6:39015079-39015101 AGAGACAGGGAGCACTGGAGAGG + Intronic
1007297774 6:40839790-40839812 ACATTGAAACAGCAATGGAGTGG + Intergenic
1009934898 6:70222591-70222613 ACAGAGATACAGCATTGGAGAGG + Intronic
1011682778 6:89799277-89799299 AAAGACAGACAGCACTGATGTGG + Intronic
1012088509 6:94860152-94860174 TCATACAGACAGCACTCCAGGGG - Intergenic
1013795152 6:113879620-113879642 GCACACCGATAGCACTGGAGTGG + Intergenic
1013998589 6:116339122-116339144 ACAGACGGACAGGACTGGGGTGG - Intronic
1014246991 6:119079235-119079257 ACATACACTCAGCACTGAACTGG - Intronic
1014261726 6:119226227-119226249 ACATACACAAAGCACAGGAAAGG + Intronic
1014337634 6:120157334-120157356 AGATACAGAGAACATTGGAGCGG - Intergenic
1014714267 6:124846314-124846336 ACATCCAGACCTCACTGAAGGGG + Intergenic
1016631617 6:146239967-146239989 ACAGTCAGACAGCACTTGATAGG - Intronic
1018202328 6:161406890-161406912 AAATGCAGACAGAACTGAAGAGG + Intronic
1019291118 7:250767-250789 GCATCCAGGCATCACTGGAGCGG - Intronic
1020427526 7:8085999-8086021 TCATGCACACAGCACTGAAGTGG - Intronic
1021320494 7:19204334-19204356 GGATACAGACAGCAATGGAGAGG - Intergenic
1023312990 7:38906656-38906678 AGATACTGACACCACTGGAGAGG + Intronic
1026998896 7:74637955-74637977 TCACCCAGACAGCAGTGGAGAGG - Intergenic
1028118613 7:87030741-87030763 ACATACAGAGAGTACTTGATTGG - Intronic
1028163741 7:87514621-87514643 AAATAAGGACAGCACTTGAGTGG - Intronic
1029345434 7:99975462-99975484 ACACTCAGACACCACTGCAGTGG - Intronic
1029346354 7:99981311-99981333 ACACTCAGACACCACTGCAGTGG + Intergenic
1029558819 7:101289206-101289228 ACACTCAGACACCACTGCAGTGG - Intergenic
1030200827 7:106901990-106902012 ATCTACAGACAGCACTCAAGGGG - Intronic
1032475261 7:132207507-132207529 ACTCACAGGCAGCAGTGGAGGGG - Intronic
1033598817 7:142874783-142874805 TCATACACACAGCACTAGAGAGG + Intronic
1034513878 7:151558508-151558530 ACATTCAGACAGCGCTCGGGTGG + Intronic
1035326584 7:158070083-158070105 ACATCCAGGCAGGGCTGGAGAGG + Intronic
1036765067 8:11544361-11544383 ACATGTGGACAGCACAGGAGAGG - Intronic
1038089063 8:24233615-24233637 ACATACAGTCAGCCTGGGAGAGG - Intergenic
1038261630 8:26001193-26001215 ACATTCATCCAGCACTGGAAGGG + Intronic
1039451822 8:37680981-37681003 AGATACAGACAGCATCGGAAGGG - Intergenic
1040584041 8:48723576-48723598 ACACACAGTAAGCAGTGGAGAGG - Exonic
1044079264 8:87863814-87863836 ACATAGAGTCAACACTGGAATGG - Intergenic
1046890173 8:119414181-119414203 ACATAGTGACAGCACAGGAATGG - Intergenic
1048792239 8:138114618-138114640 ATAATCAGACAGCACTGGAGAGG + Intergenic
1051101467 9:13527230-13527252 AGATACAGAGATCACTGAAGAGG - Intergenic
1051697631 9:19786659-19786681 AGATACACAGAGCACAGGAGAGG - Exonic
1052626528 9:30982587-30982609 ACGTACAGCCAGCACTCAAGGGG + Intergenic
1056411128 9:86328396-86328418 ACATACTGACAGTGCTGCAGGGG - Exonic
1059893114 9:118827518-118827540 CCATACAGAGAGCAATGGATAGG + Intergenic
1060140507 9:121205486-121205508 GGAGAGAGACAGCACTGGAGGGG + Intronic
1062039923 9:134399817-134399839 AGATTCAGCCAGCACTGCAGGGG - Intronic
1188217853 X:27501262-27501284 ACACACACACAGCAGAGGAGGGG - Intergenic
1188818030 X:34739392-34739414 TTATACAGACAGCAAGGGAGGGG - Intergenic
1193061430 X:77212318-77212340 AACTACAGACAGCACTCAAGGGG - Intergenic
1193190783 X:78568080-78568102 ACAAACCGACAGCACTGAATGGG + Intergenic
1193801109 X:85937448-85937470 ACATACAGAGAAAACTGGACTGG + Intronic
1194675676 X:96790929-96790951 ACACACAGACAGCACTGATGAGG - Intronic
1195014136 X:100761884-100761906 ACATACAGGAAGAACTTGAGAGG - Intergenic
1195677753 X:107520255-107520277 TCTTACAGACAGCATTGAAGTGG + Intergenic
1197196462 X:123707176-123707198 ACATACAGAAAAAACTGGAAAGG - Intronic
1199618986 X:149682527-149682549 ACGTACAGAAAGAACTGGATTGG - Intergenic
1199687866 X:150280451-150280473 ACATTCAGAAAGCACTTGTGAGG - Intergenic
1200361725 X:155613346-155613368 ACATACAGTGAGCACTAGAAGGG + Intronic
1202296181 Y:23359826-23359848 ACAAAGAGATAGCTCTGGAGAGG - Intergenic
1202574626 Y:26310770-26310792 ACAAAGAGATAGCTCTGGAGAGG + Intergenic