ID: 1173834028

View in Genome Browser
Species Human (GRCh38)
Location 20:46113451-46113473
Sequence TCCTCCCCAAGATTGCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173834028_1173834034 18 Left 1173834028 20:46113451-46113473 CCATACAGCAATCTTGGGGAGGA No data
Right 1173834034 20:46113492-46113514 CTGAGTAGTCAGGTGTTCATAGG No data
1173834028_1173834031 -10 Left 1173834028 20:46113451-46113473 CCATACAGCAATCTTGGGGAGGA No data
Right 1173834031 20:46113464-46113486 TTGGGGAGGAAGGAGGTCCTTGG No data
1173834028_1173834035 24 Left 1173834028 20:46113451-46113473 CCATACAGCAATCTTGGGGAGGA No data
Right 1173834035 20:46113498-46113520 AGTCAGGTGTTCATAGGAGAAGG No data
1173834028_1173834033 8 Left 1173834028 20:46113451-46113473 CCATACAGCAATCTTGGGGAGGA No data
Right 1173834033 20:46113482-46113504 CTTGGTTTTACTGAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173834028 Original CRISPR TCCTCCCCAAGATTGCTGTA TGG (reversed) Intergenic
No off target data available for this crispr