ID: 1173838429

View in Genome Browser
Species Human (GRCh38)
Location 20:46140394-46140416
Sequence CAGAGGGGAAAGCCTAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173838422_1173838429 0 Left 1173838422 20:46140371-46140393 CCACAGGAAGGAGTTGGAGGGGG No data
Right 1173838429 20:46140394-46140416 CAGAGGGGAAAGCCTAGGATGGG No data
1173838417_1173838429 6 Left 1173838417 20:46140365-46140387 CCTGAGCCACAGGAAGGAGTTGG No data
Right 1173838429 20:46140394-46140416 CAGAGGGGAAAGCCTAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173838429 Original CRISPR CAGAGGGGAAAGCCTAGGAT GGG Intergenic
No off target data available for this crispr