ID: 1173841483

View in Genome Browser
Species Human (GRCh38)
Location 20:46160292-46160314
Sequence TCATCCAGATGAGGGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173841483_1173841487 13 Left 1173841483 20:46160292-46160314 CCTCCAGGCCCTCATCTGGATGA No data
Right 1173841487 20:46160328-46160350 ATTCACATGAAGATGTGCTATGG No data
1173841483_1173841488 14 Left 1173841483 20:46160292-46160314 CCTCCAGGCCCTCATCTGGATGA No data
Right 1173841488 20:46160329-46160351 TTCACATGAAGATGTGCTATGGG No data
1173841483_1173841489 22 Left 1173841483 20:46160292-46160314 CCTCCAGGCCCTCATCTGGATGA No data
Right 1173841489 20:46160337-46160359 AAGATGTGCTATGGGCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173841483 Original CRISPR TCATCCAGATGAGGGCCTGG AGG (reversed) Intergenic