ID: 1173842675

View in Genome Browser
Species Human (GRCh38)
Location 20:46168306-46168328
Sequence GGCTTAACCCCTTGTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173842675_1173842678 -9 Left 1173842675 20:46168306-46168328 CCCAGCACACAAGGGGTTAAGCC No data
Right 1173842678 20:46168320-46168342 GGTTAAGCCAGCCTTGGAGTTGG No data
1173842675_1173842683 7 Left 1173842675 20:46168306-46168328 CCCAGCACACAAGGGGTTAAGCC No data
Right 1173842683 20:46168336-46168358 GAGTTGGGAGCTGGAGCCCATGG No data
1173842675_1173842681 -2 Left 1173842675 20:46168306-46168328 CCCAGCACACAAGGGGTTAAGCC No data
Right 1173842681 20:46168327-46168349 CCAGCCTTGGAGTTGGGAGCTGG No data
1173842675_1173842679 -8 Left 1173842675 20:46168306-46168328 CCCAGCACACAAGGGGTTAAGCC No data
Right 1173842679 20:46168321-46168343 GTTAAGCCAGCCTTGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173842675 Original CRISPR GGCTTAACCCCTTGTGTGCT GGG (reversed) Intergenic
No off target data available for this crispr