ID: 1173844402

View in Genome Browser
Species Human (GRCh38)
Location 20:46178843-46178865
Sequence CCTAAGAGGCTGAGCCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173844397_1173844402 2 Left 1173844397 20:46178818-46178840 CCTGGAGCCTGACAAGGAGTCTC 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218
1173844393_1173844402 20 Left 1173844393 20:46178800-46178822 CCAAGGCCAGTTGAGAGTCCTGG 0: 1
1: 0
2: 2
3: 12
4: 161
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218
1173844392_1173844402 21 Left 1173844392 20:46178799-46178821 CCCAAGGCCAGTTGAGAGTCCTG 0: 1
1: 0
2: 0
3: 20
4: 141
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218
1173844395_1173844402 14 Left 1173844395 20:46178806-46178828 CCAGTTGAGAGTCCTGGAGCCTG 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218
1173844398_1173844402 -5 Left 1173844398 20:46178825-46178847 CCTGACAAGGAGTCTCTGCCTAA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218
1173844391_1173844402 22 Left 1173844391 20:46178798-46178820 CCCCAAGGCCAGTTGAGAGTCCT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218
1173844390_1173844402 30 Left 1173844390 20:46178790-46178812 CCTTCATACCCCAAGGCCAGTTG 0: 1
1: 0
2: 5
3: 11
4: 148
Right 1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173844402 Original CRISPR CCTAAGAGGCTGAGCCTAGA GGG Intronic
901254165 1:7806684-7806706 CTTAGGAGGCTGAGGCAAGAGGG + Intronic
901351054 1:8597194-8597216 CTTAGGAGGCTGAGGCCAGAGGG - Intronic
903451559 1:23456989-23457011 CCAAGCAGGCTCAGCCTAGATGG + Intronic
904113341 1:28143777-28143799 CTTAGGAGGCTGTGCCTGGAGGG + Intergenic
905425765 1:37882997-37883019 CCCAAGAGGCTGAGCCTCAGGGG - Intronic
905450383 1:38052260-38052282 CTGAAGGGGCTGAGCTTAGAGGG - Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
909560610 1:77005498-77005520 CCTGAGAGGAGGAGCCAAGATGG - Intronic
911363603 1:96909987-96910009 CCTCAGAAGCTGTGCCTACAAGG - Intergenic
911533346 1:99072286-99072308 TCCATGAAGCTGAGCCTAGAAGG + Intergenic
915271774 1:154758711-154758733 CCCCAGAGGCTGAGCTGAGAGGG - Intronic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915589841 1:156864525-156864547 CCTGAGAGGCTGAGCACTGAGGG + Intronic
916407485 1:164511594-164511616 CCTCTGGGGCTGAGCCTGGACGG - Intergenic
918181445 1:182088407-182088429 CCCATGAGGATGAGCCAAGACGG - Intergenic
918386431 1:184012958-184012980 CTCAAGAAGCTGAGCCTAGGGGG + Intronic
919762521 1:201106878-201106900 CCTATGAGGTTGAGCCTCCAAGG - Intronic
1063333480 10:5186035-5186057 GCCAAGAGGCTCAGCCTAAATGG + Intergenic
1064579579 10:16780345-16780367 CTGAAGAGGCTGAGCCCAGTAGG - Intronic
1064673561 10:17739459-17739481 CTTAAGTAGCTGAGCCTATAGGG + Intergenic
1065398303 10:25265731-25265753 GCCAAGAGGGTGATCCTAGATGG + Intronic
1067552453 10:47245299-47245321 CCTAAGAGGCTGGGGCTGGTGGG - Intergenic
1069505610 10:68995141-68995163 CCTAAGTAGCTGAGACTACAGGG + Intronic
1069699491 10:70411570-70411592 CCCAGGAGGCTGAGCCCAGGAGG - Intronic
1069929372 10:71872229-71872251 CACAGGAGGCTGAGCCGAGATGG + Intergenic
1069968505 10:72143443-72143465 CTTGAGAGGCTGAGACTGGAGGG - Intronic
1070030861 10:72676031-72676053 CCCAAGTAGCTGAGACTAGAGGG + Intergenic
1070548872 10:77474952-77474974 CCTCAGATCATGAGCCTAGAAGG + Intronic
1070844379 10:79510010-79510032 ACTGAGGGGATGAGCCTAGAAGG - Intergenic
1070929418 10:80250298-80250320 ACTGAGGGGATGAGCCTAGAAGG + Intergenic
1072392295 10:94999760-94999782 TCTCAGAGACAGAGCCTAGAAGG - Intergenic
1075768043 10:124910178-124910200 CCCAGGAGGCTGAGCCTGGGAGG + Intergenic
1076106457 10:127827407-127827429 CCAGAGAGGCTGAGGGTAGAGGG + Intergenic
1076174726 10:128359285-128359307 CCCAAGAGGTGGAGCCCAGATGG + Intergenic
1076918767 10:133440738-133440760 CCTAAGAGGCTGTGAGGAGAGGG - Intergenic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1077893333 11:6435552-6435574 CTTCAGAGGCTGAGCCCGGAAGG - Intronic
1078130221 11:8608224-8608246 CCTAAGAGGTTGAGGCTGCAGGG - Intergenic
1080357594 11:31469497-31469519 CCTGTTAGGCTGAGCCTAGTAGG - Intronic
1083297323 11:61722022-61722044 CCTCAGGGGCTGAGACTGGAGGG - Intronic
1084133392 11:67155544-67155566 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1084570728 11:69958203-69958225 CTTAGGAGGCTGAGCTCAGAAGG - Intergenic
1084744331 11:71158849-71158871 CCTATGAGGCTGACACTAGCAGG + Intronic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1087261646 11:96018719-96018741 CCCAAGTGGCTGAGACTACAGGG + Intronic
1088242808 11:107788833-107788855 CCCAAGAAGCTGAGACTACAGGG - Intergenic
1088886330 11:114010385-114010407 CCCAGGAGGCTGAGGCTACAGGG - Intergenic
1090726295 11:129530267-129530289 CCAAGGAGGCTGAGTCCAGATGG - Intergenic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1094820576 12:34221000-34221022 CTTGGGAGGCTGAGCCTGGAGGG - Intergenic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1096723338 12:53540837-53540859 CTTAGGAGGCTGAGCCTAGGAGG - Intronic
1101595413 12:106160288-106160310 CCCAAGTAGCTGAGACTAGAGGG + Intergenic
1102694757 12:114790193-114790215 CTTGAGAGGCTGAGGTTAGAAGG - Intergenic
1102818184 12:115885841-115885863 CTACAGATGCTGAGCCTAGAGGG - Intergenic
1103292111 12:119855014-119855036 CTTAAGAGGCTGAGGCGGGAGGG + Intronic
1103627855 12:122234365-122234387 CCCAGGAGGCTGAGCCTGGGAGG - Intronic
1108267642 13:48728662-48728684 CCTGAGAGGCTGAGCCCCGGGGG + Intergenic
1108609630 13:52071400-52071422 GCTAAGAGGCAGGGGCTAGAGGG - Intronic
1110999245 13:82157205-82157227 CCTAAGAGGCTGAGAACTGATGG + Intergenic
1112277562 13:98035484-98035506 CTTGAGAGGCTGAGGCGAGAAGG + Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113073906 13:106449321-106449343 CCTACGAGGCTGACCCGAAATGG - Intergenic
1113684661 13:112274499-112274521 CCTGAGAGGCTGGGCCTGCAGGG + Intergenic
1113968026 13:114165663-114165685 CCTAAGAGGCAGAGTTTAGAAGG - Intergenic
1114161216 14:20169875-20169897 CTCAGGAGGCTGAGGCTAGAGGG - Intergenic
1121139433 14:91528302-91528324 GCTGAGAGGCTGAGGCAAGAGGG - Intergenic
1122016854 14:98803597-98803619 GCTGAGAGGCTGATCCTAGATGG + Intergenic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1125783849 15:42297403-42297425 CTTGGGAGGCTGAGGCTAGAGGG - Intronic
1125966794 15:43881233-43881255 CCTCTGAGGCTGAAGCTAGAGGG - Intronic
1126376287 15:48000171-48000193 GGTGAGAGGCTGAGACTAGATGG + Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1127206458 15:56725080-56725102 TCTAAGAAGCTAAGCCTGGAGGG - Intronic
1127835690 15:62789198-62789220 CCTGTGAGGCTGAGCCTCAAGGG + Intronic
1128504690 15:68259411-68259433 CCCAAGAGGCTGAGGTGAGAGGG - Intergenic
1128521583 15:68378533-68378555 CTCAAGAGGCTGAGGCAAGAGGG + Intronic
1134524738 16:14934801-14934823 CTAAAGAGGCTGAGCCAGGACGG + Intronic
1134712326 16:16333288-16333310 CTAAAGAGGCTGAGCCAGGACGG + Intergenic
1134954502 16:18375406-18375428 CTAAAGAGGCTGAGCCAGGACGG - Intergenic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1138417659 16:56880377-56880399 ACTAAGAGGCTAAGTCTTGAGGG + Intronic
1138442241 16:57042074-57042096 CCTCAGAGGCTCTGCCTAGCGGG - Intronic
1139440967 16:66966619-66966641 CCTGAGTGTCTGAGCCTGGAGGG - Intronic
1139618579 16:68117613-68117635 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1140478101 16:75249014-75249036 CCTAAGAGGCTGGGCAGAGGAGG + Intronic
1145715888 17:27020728-27020750 CTCAGGAGGCTGAGGCTAGAGGG - Intergenic
1146558544 17:33848333-33848355 CCTAAGAGGTTGAGCATGTAAGG - Intronic
1148001160 17:44388036-44388058 CCTAAGTGGCTGACACTTGAAGG + Intronic
1149704903 17:58686211-58686233 CCTAAGAAGCTGAGACTAACAGG - Intronic
1150426481 17:65081300-65081322 CCCAAGAGGTTGAGGCTACAGGG - Intergenic
1152360225 17:79829726-79829748 CCTTAAAGGATGAGCCAAGATGG - Intergenic
1154124842 18:11681914-11681936 CCCAGGAGGCTGAGGCAAGAGGG + Intergenic
1154257624 18:12797806-12797828 CCCAAGAGGTTGAGGCTACAGGG - Intronic
1154471769 18:14710090-14710112 CTTAGGAGGCTGAGGCAAGAGGG + Intergenic
1155492175 18:26410202-26410224 CCTGAGAGGCTGAGTCAGGAGGG - Intergenic
1156825009 18:41420254-41420276 CCTAAGATGCTGGCCCCAGAAGG + Intergenic
1158220881 18:55149612-55149634 CCAAAGAGGCAGAGCTGAGAAGG - Intergenic
1162663475 19:12190197-12190219 TTTAAGAGGCTGAGGCTAGAGGG - Intergenic
1163315832 19:16539927-16539949 CTCAAGAGGCTGAGGCTGGAGGG - Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
925804075 2:7631259-7631281 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804082 2:7631293-7631315 CCTAAGAGGCTGGGCATGTATGG - Intergenic
925804089 2:7631327-7631349 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804096 2:7631361-7631383 CCTAAGAGGCTGGGCATGGGTGG - Intergenic
925804112 2:7631427-7631449 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804119 2:7631461-7631483 CCTAAGAGGCTGGGCATGGATGG - Intergenic
925804127 2:7631495-7631517 CCTAAGAGGCTGGGCATGGATGG - Intergenic
929123966 2:38506314-38506336 CCTAAGAAGCTGGGACTACAGGG + Intergenic
929149849 2:38737766-38737788 CTTAGGAGGCTGAGGCTGGAGGG - Intronic
930147065 2:48018170-48018192 CCTAAGAGGCTGGGAGTTGAGGG - Intergenic
931637032 2:64350247-64350269 CTCAAGAGGCTGAGCCCAGGAGG + Intergenic
931667064 2:64617314-64617336 CCTCAGAGACTGAGTCCAGATGG - Intergenic
931726560 2:65117171-65117193 CTCAAGAGGCTGAGGCAAGAGGG - Intronic
932549626 2:72754719-72754741 CTTAGGAGGCGGAGGCTAGAGGG - Intronic
933357346 2:81228649-81228671 CCTCAGAGTCTGAGGCTGGAGGG + Intergenic
935628903 2:105195715-105195737 CCAAAGGGGGTGAACCTAGAGGG + Intergenic
940428121 2:153553845-153553867 CCAAAGATGCTGAGGCTACAGGG + Intergenic
940993505 2:160121676-160121698 CTCATGAGGCTGAGCCTGGAAGG + Intronic
944159488 2:196643272-196643294 CCTCAGAGGCTGGGCCAAGTTGG + Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945264332 2:207875711-207875733 CCTAAGTAGCTGAGACTACAAGG - Intronic
945991707 2:216401033-216401055 CTTAGGAGGCTGAGTCAAGAGGG - Intergenic
946190682 2:218006263-218006285 CCTTAGAGCCTGAGCCTGGCAGG + Intergenic
946682701 2:222233702-222233724 CCATAGACCCTGAGCCTAGAGGG + Intronic
947827430 2:233115838-233115860 ACTACGAGGCTGAGCCAAGCAGG + Intronic
1171225350 20:23437977-23437999 CCTGGGAGGCTGAGGCTAGGAGG - Intergenic
1172495078 20:35375857-35375879 GGTAGGAGGCTGAGCCTGGAAGG + Intronic
1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG + Intronic
1174015674 20:47486192-47486214 CTCAAGAGGCTGAGGCTGGAGGG + Intergenic
1174852778 20:54011792-54011814 CCTGGGTGGCTGAGCCAAGATGG + Intronic
1177604134 21:23356899-23356921 CCTAAGTAGCTGAGACTACAGGG + Intergenic
1181371683 22:22424083-22424105 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1181672573 22:24432557-24432579 CCTGAGAGGCTGAGCATGGGGGG + Intronic
1182090879 22:27594066-27594088 CCTAAGAGGCTGAACGAAGGTGG + Intergenic
1183359974 22:37378458-37378480 GCGAAGAGGCTGAGCGTGGAGGG + Intronic
1183755738 22:39762525-39762547 CCCAAGAGGTTGAGGCTACAGGG - Intronic
1184046381 22:41975015-41975037 CCTAAAAGGCTGAGCGTAAATGG - Intergenic
1184565378 22:45288778-45288800 TCTAAGAGGGAGCGCCTAGAAGG + Intronic
1184836488 22:47025730-47025752 GCGAAGAGGCTGTGCTTAGAGGG + Intronic
1185305280 22:50112083-50112105 CCTAGGAGGCTGAGCCCACCAGG - Intronic
952230366 3:31423356-31423378 GCTTTGAGGCTAAGCCTAGATGG + Intergenic
953528139 3:43712606-43712628 CCCAAGAGGCTTAAACTAGAAGG + Intronic
953754926 3:45637769-45637791 CCTAACCTGCTGAGCCTTGATGG + Intronic
953976500 3:47385551-47385573 CCTAAGTAGCTGGGCCTACAAGG - Intronic
954352879 3:50060032-50060054 CTAAAGAGGCTGAGGCGAGATGG + Intronic
954553642 3:51502151-51502173 CCTAAGAGGCAGAGCCCTTAGGG + Intergenic
955188447 3:56737415-56737437 TCTTAGGGGCTCAGCCTAGAAGG + Intronic
956178160 3:66493669-66493691 CCTGAGTAGCTGAGACTAGAAGG - Intronic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
957344246 3:78941954-78941976 CCTAACAGGATGAGCTAAGAAGG + Intronic
958911755 3:100001874-100001896 CCTAAGCTGCTCAGCATAGAAGG + Intronic
959609373 3:108277000-108277022 CCTAGGGGGCTTAGCCTACAAGG - Intergenic
961403964 3:126666102-126666124 GCTAAGAGGCTGTGGCGAGAAGG - Intergenic
961413674 3:126742085-126742107 CCTAAAACGCTGAACCCAGATGG - Intronic
962617027 3:137136620-137136642 GCCAAGAGGCTCAGCCTAAATGG - Intergenic
962814884 3:138988657-138988679 CCTAAGAGACAGAGCCCAAAGGG - Intergenic
963318091 3:143782793-143782815 ACTAAGAGGCTAAGCCTAGCAGG + Intronic
965151487 3:164982763-164982785 CATAGGAGGCTGAGGCTAGAGGG - Intronic
968231731 3:197008534-197008556 TCAGAGAGGCTGAGTCTAGAAGG - Intronic
969219032 4:5747323-5747345 TCTCAGAGGCTGAGCCAAGATGG + Intronic
970501675 4:16683739-16683761 GCTAAGCTGCTGAGCCTTGAAGG - Intronic
970547124 4:17140990-17141012 CCCAGGAGGCTGAGGCTGGAGGG + Intergenic
972336706 4:38113338-38113360 CCTAAGAGGGTGGGCCTAGCAGG - Intronic
972500012 4:39669105-39669127 CTAAAAAGGCTGAGCCAAGAAGG + Intergenic
972758982 4:42082721-42082743 CCTAAGTAGCTGGGACTAGAAGG - Intronic
974059067 4:57013660-57013682 CCTAAGTGGCTGAGACCACAAGG + Intronic
977557132 4:98497743-98497765 CCTCAGGAGCTGAGTCTAGAGGG + Intronic
977910858 4:102534416-102534438 CCAAAGAGGCTGACACCAGAGGG - Intronic
978325891 4:107553840-107553862 GCTAAAAGGCTGAACCTAAAAGG + Intergenic
982567576 4:157005399-157005421 CTTAAGTGGCTGAGCCAAGTTGG + Intergenic
983105061 4:163676458-163676480 CATAAGAGGCTGTGCATAGTAGG + Intronic
985765410 5:1776951-1776973 CCTGCGAGGCTGAGCCCAGGAGG - Intergenic
985980405 5:3457706-3457728 TCTAAGATGCTGACCCCAGAGGG - Intergenic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
988737175 5:34034089-34034111 CCTAAGAGGCCAAGGCTACAGGG + Intronic
989948339 5:50266950-50266972 CCTAAGGAGGTGAGCCTAGAAGG - Intergenic
992731649 5:79675924-79675946 TCAAAGAGGCTGAGCCCTGATGG + Intronic
995423417 5:111992099-111992121 CGTAAGAGGTGGAGCCAAGATGG - Intronic
995484306 5:112623915-112623937 TTTAGGAGGCTGAGCCAAGAAGG - Intergenic
995521594 5:113012250-113012272 CTTAAGAGGCTGAGGCAAAAAGG + Intronic
995784448 5:115814182-115814204 CCGAAGAGCATGATCCTAGAGGG + Intronic
997369667 5:133350440-133350462 CCTGAGAGCCTGAGGCTGGAGGG - Intronic
998328727 5:141304769-141304791 CCTGAGTAGCTGAGACTAGAGGG + Intergenic
1000624587 5:163524755-163524777 CTTAAGAGGCTGAGATGAGAAGG - Intergenic
1001825818 5:174744132-174744154 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1004582225 6:16965328-16965350 TCCAGGAAGCTGAGCCTAGAAGG + Intergenic
1004628584 6:17399833-17399855 TCCAAGAGGCTGAACATAGAAGG + Intronic
1005344235 6:24873682-24873704 CCAAAGAGCCTCAGCCTAAAAGG - Exonic
1006799556 6:36751214-36751236 CCTCAGAGGCTGAGCTAAGCTGG - Intronic
1007439275 6:41844094-41844116 CCTAAGAAGCTGAGACTACATGG - Intronic
1007743748 6:44029614-44029636 TGTATGAGGCTGAGCCAAGAGGG - Intergenic
1011547932 6:88501015-88501037 CCTCAGTGGCTGGGACTAGAGGG - Intergenic
1012318234 6:97807799-97807821 CCTGAGAGGCTGGGACTAAAGGG - Intergenic
1013585164 6:111571823-111571845 CTTGAGAGGCTGAACCTAGGAGG + Intronic
1013746024 6:113347526-113347548 CATAAGAAGCAGAGCCAAGAGGG - Intergenic
1014067468 6:117144325-117144347 CTCAGGAGGCTGAGGCTAGAGGG + Intergenic
1014153109 6:118081525-118081547 CTCAAGAGGCTGAGGCAAGAGGG + Intronic
1015144296 6:129968294-129968316 CCAAAGAGACTAAGCCTAGTAGG + Intergenic
1019988482 7:4675782-4675804 CTCAAGAGGCTGAGCCTGGGAGG - Intergenic
1022331859 7:29387023-29387045 GTTAAGTGGCTGAGCCTAGATGG - Intronic
1022727114 7:32991457-32991479 CCTGAGGGGCTGACCCGAGAGGG + Intronic
1025046467 7:55696173-55696195 CCTGAGGGGCTGACCCGAGAGGG - Intergenic
1026027981 7:66762480-66762502 CTCAAGAGGCTGAGACGAGAGGG + Intronic
1028091991 7:86714224-86714246 CCTTAGAGGCAGAGCCAAAATGG - Intronic
1028938947 7:96498201-96498223 CTTAAAAGCATGAGCCTAGAAGG - Intronic
1029652573 7:101903438-101903460 CCTACAAGGCTGAGCCTGGCAGG + Intronic
1030554469 7:111006062-111006084 CATCTGAGTCTGAGCCTAGAAGG + Intronic
1030951239 7:115792660-115792682 CTTGAGAGGCTGAGGCCAGAAGG + Intergenic
1032467049 7:132152678-132152700 CCCAAGAGGCTCAGCCTTCACGG - Intronic
1034243306 7:149625659-149625681 CTTAAGAGGCTGAGGATGGAGGG + Intergenic
1035112790 7:156497355-156497377 GCTGAGAGGCTGAGCCTGGGTGG + Intergenic
1036513178 8:9419455-9419477 CCTCAGAGGCTGAGACCCGATGG - Intergenic
1037530038 8:19764159-19764181 CAAAAGTGGCTGAGCCTTGATGG + Intergenic
1039364689 8:36917456-36917478 CCTAGGAGGCTGAGGTGAGAGGG - Intronic
1039495639 8:37978081-37978103 CCTAGGAGGCTGAGGCAGGAGGG - Intergenic
1039847623 8:41336915-41336937 CCTCAGAGTCTGAGCCTGCATGG - Intergenic
1047885794 8:129248931-129248953 GCTCAGAGGCTGAGGCTTGAAGG - Intergenic
1052399921 9:27987380-27987402 CTCAAAAGGCTGAGCCTGGAGGG - Intronic
1052513374 9:29450388-29450410 CCTTAGAGGAGGAGCCAAGATGG + Intergenic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1053327644 9:37169953-37169975 CTCAAGAGGCTGAGGCTGGAGGG + Intronic
1053441159 9:38117627-38117649 CTCAAGAGGCTGAGCTCAGAGGG - Intergenic
1059123664 9:111663422-111663444 AGAAAGAGGCTGAGCCTAGATGG + Intronic
1060145108 9:121245858-121245880 CTCAAGAGGCTGAGGCAAGAGGG - Intronic
1061682602 9:132250364-132250386 CCCAAGAAGCTGAGCCTGCAAGG + Intergenic
1061762327 9:132859342-132859364 CCTGGGAGGCTGAGCCTGGGAGG - Intronic
1186033712 X:5397502-5397524 GCAAAGAGGCAGAGGCTAGAGGG + Intergenic
1188850985 X:35131715-35131737 CCTAAGAGGCTGATACCAGCTGG + Intergenic
1191039809 X:56067428-56067450 CATGAGAGGCAGTGCCTAGATGG + Intergenic
1194863110 X:99029137-99029159 CCTTAGAGGCTGAGGCACGAGGG - Intergenic
1195375287 X:104220808-104220830 CCTCAGAGGCTGAGCAGAGAAGG + Intergenic
1197197775 X:123720321-123720343 CCTAAGTGGCTGGGACTATAGGG - Intronic
1198512912 X:137372209-137372231 GCAAAGAGGCTGATCCTGGATGG - Intergenic
1199761637 X:150908961-150908983 CTTAAGAGGCTGAGGCAGGAGGG + Intergenic
1201147989 Y:11076521-11076543 CCTATGAGGCTGACACTAGCAGG + Intergenic
1201269418 Y:12240070-12240092 CATCAGAGGCTGAGCATAAATGG - Intergenic