ID: 1173846012

View in Genome Browser
Species Human (GRCh38)
Location 20:46189228-46189250
Sequence GCCACTCCAGTGATTAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173846007_1173846012 12 Left 1173846007 20:46189193-46189215 CCAGGGGCACATTATCTTCTAAG 0: 1
1: 0
2: 4
3: 10
4: 132
Right 1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 119
1173846004_1173846012 20 Left 1173846004 20:46189185-46189207 CCCCTTAGCCAGGGGCACATTAT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 119
1173846005_1173846012 19 Left 1173846005 20:46189186-46189208 CCCTTAGCCAGGGGCACATTATC No data
Right 1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 119
1173846006_1173846012 18 Left 1173846006 20:46189187-46189209 CCTTAGCCAGGGGCACATTATCT 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173846012 Original CRISPR GCCACTCCAGTGATTAGAGG GGG Intronic
900358925 1:2278705-2278727 GCCACTCCAGAGATCAGGTGGGG - Intronic
907467162 1:54646130-54646152 CCCACTCCAGTGATAACAAGTGG - Intronic
909882220 1:80893999-80894021 GCCTCTACAGTTAGTAGAGGTGG - Intergenic
910177991 1:84451746-84451768 CCCACTCAAGTTAATAGAGGAGG - Intergenic
915290008 1:154877222-154877244 CCCACTCCTGTTGTTAGAGGGGG - Intergenic
918077194 1:181179472-181179494 ACCTCTCCACTGATTAGATGAGG - Intergenic
918138527 1:181700114-181700136 GGCACTCCAATGTCTAGAGGAGG + Intronic
919560893 1:199116758-199116780 GGCCCTACAGTGATTAGAGAAGG - Intergenic
920866617 1:209758734-209758756 CTGACTCCAGTGATCAGAGGAGG + Exonic
1064286737 10:13998102-13998124 GCCACTCCAAAGCTTAGAGATGG - Intronic
1067015529 10:42754544-42754566 GCCACTACAGGGAGCAGAGGCGG + Intergenic
1071463418 10:85919526-85919548 GCCACTCCAGCAATTACTGGAGG + Intronic
1073793949 10:106967721-106967743 TCCCCTCCAGTGCTTAGAAGGGG + Intronic
1074808025 10:117073640-117073662 GCAAATCCAGTGAGGAGAGGTGG - Intronic
1077917707 11:6622050-6622072 GCCACGGCAGTGATGAGGGGTGG + Exonic
1079391507 11:20025731-20025753 GCAAGGCCAGTGATTTGAGGTGG - Intronic
1085150593 11:74249935-74249957 GCCACTTCATTAATTAGTGGAGG - Intronic
1086390524 11:86358541-86358563 GCTACTCCATTGATAAGAGTAGG + Intergenic
1088878064 11:113952224-113952246 CCCACGCCAGTGATTAGATTAGG + Intergenic
1096469623 12:51868120-51868142 GCCCCTCCAGGGTTTTGAGGAGG + Intergenic
1096758465 12:53819451-53819473 GCCACCCCAGTGCTTGCAGGAGG - Intergenic
1099375273 12:81891168-81891190 GCCACTCGCGTGATAAGAGCTGG - Intergenic
1103635742 12:122303737-122303759 GCCTCTCCTGTGATTGGAGGTGG + Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1109931987 13:69227647-69227669 GAGACTCCAGTGATTAGACTAGG - Intergenic
1114069913 14:19098252-19098274 GCCCCTCCAGGGAGCAGAGGCGG - Intergenic
1114092348 14:19301750-19301772 GCCCCTCCAGGGAGCAGAGGCGG + Intergenic
1118719469 14:68583959-68583981 GCCACTCCAGTCACCAGATGAGG + Intronic
1120163599 14:81170613-81170635 GCAGCTCCAGTGATTGGAGGGGG + Intergenic
1120207388 14:81601069-81601091 GCCCCTGCAGTGATTAGGGCAGG - Intergenic
1124156774 15:27233034-27233056 TCCACTCCAGGGACAAGAGGAGG - Intronic
1126959608 15:53977038-53977060 GCCACTCCCGTGATGAGTGAAGG + Intergenic
1127279466 15:57476577-57476599 GCCTCTGAAGTGATTAGATGTGG + Intronic
1128337694 15:66797944-66797966 GCCACTCCTGGGATAAGCGGAGG - Intergenic
1129757179 15:78105520-78105542 GCCCCTTCAGTGATAAGTGGGGG - Intronic
1130625510 15:85510059-85510081 GGGACTGCAGGGATTAGAGGAGG - Intronic
1131524654 15:93143323-93143345 GGCACTGTAGAGATTAGAGGAGG - Intergenic
1134248507 16:12557857-12557879 GCCATTCCAGCGAGTGGAGGAGG + Intronic
1135158018 16:20070953-20070975 GCCCCACCAGTGACCAGAGGAGG - Intronic
1138144630 16:54597339-54597361 AGCACTTCAGTGATAAGAGGAGG - Intergenic
1138352156 16:56351865-56351887 GCCACTGCTGAGATTACAGGAGG - Intronic
1141593438 16:85083358-85083380 GACATACCACTGATTAGAGGAGG - Intronic
1141596474 16:85100050-85100072 GTAACCCCAGGGATTAGAGGAGG - Intronic
1149110049 17:53018103-53018125 TCCACTTCAGTGATTAAAAGAGG - Intergenic
1151110449 17:71670219-71670241 GACACTGGAGTGATTAAAGGAGG - Intergenic
1151245578 17:72792064-72792086 ACCACTGCAGTGACTAAAGGGGG - Intronic
1153577277 18:6535338-6535360 GACCCTCCAGTGGTTAGATGTGG - Intronic
1153716394 18:7853651-7853673 GCATCTCCATTGATTAGAAGTGG + Intronic
1155153425 18:23139611-23139633 TCCAGTCCAGTGAACAGAGGTGG - Intronic
1165693087 19:37879105-37879127 GGCACTCCAGTGTTTGGAAGGGG - Intergenic
1168043034 19:53774163-53774185 GCCTCCACATTGATTAGAGGAGG + Intergenic
927521896 2:23703986-23704008 CCCACTCCTGTGGTTGGAGGGGG - Intronic
936927751 2:117754990-117755012 GGCACTCCAACTATTAGAGGTGG - Intergenic
937434403 2:121868326-121868348 GTCACACCAGTGATAAGAGTGGG + Intergenic
937992511 2:127672503-127672525 GCCCCTCCTGTGATGACAGGTGG - Intronic
942661173 2:178266673-178266695 TTCACTCCAGTGATAACAGGTGG + Intronic
943404456 2:187462122-187462144 CCCACGGCAGTGACTAGAGGTGG - Intergenic
946223049 2:218245676-218245698 GCCATTGCAGTGACTAAAGGAGG + Intronic
946474676 2:219995938-219995960 GACACTCAAATGATTTGAGGGGG - Intergenic
947302282 2:228701609-228701631 TCCACTACAGTGATTTGAAGTGG - Intergenic
1172206815 20:33168196-33168218 GCCACTCACGCGTTTAGAGGAGG - Intronic
1173819823 20:46012738-46012760 GCCATGTCAGTGCTTAGAGGTGG + Intronic
1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG + Intronic
1180488380 22:15820816-15820838 GCCCCTCCAGGGAGCAGAGGCGG - Intergenic
1182900493 22:33894396-33894418 GCCACCCTAGTGAGTAGAGTAGG - Intronic
1184128198 22:42502083-42502105 CCGCCTCCAGTGATAAGAGGGGG - Intergenic
1184136988 22:42555396-42555418 CCGCCTCCAGTGATAAGAGGGGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955622660 3:60881351-60881373 GCCTATCCAGTGATGAGAGTGGG - Intronic
955960029 3:64331034-64331056 GCCAATTCAGTCACTAGAGGAGG + Intronic
959564057 3:107816150-107816172 GCAACACCAGTAATTAGTGGTGG + Intergenic
960329651 3:116343134-116343156 TCCACTCCAGGGATCAGAGATGG - Intronic
961150469 3:124633391-124633413 GCCACATCAGTGATTAGAGCAGG - Intronic
970925101 4:21442691-21442713 GACACTCAAGTGTTGAGAGGCGG - Intronic
975068692 4:70103947-70103969 GCCACTCCTGTATTTAGAGTTGG + Intergenic
975388620 4:73788869-73788891 GCCAATCTAGAGATTTGAGGAGG + Intergenic
978680573 4:111376850-111376872 GCCACTGATGTGATAAGAGGTGG + Intergenic
979059176 4:116033794-116033816 GCCTCTCCAATGAATAAAGGAGG + Intergenic
985027142 4:185749127-185749149 ACCACTCCAGTGGTTAGCTGGGG - Intronic
988459234 5:31417715-31417737 GCCACTCCAATGTTAAGAGGTGG + Intronic
990303268 5:54470587-54470609 GCTACTCTTGTCATTAGAGGTGG - Intergenic
992550422 5:77854579-77854601 TTCACCCCAGTGATTAGAGGTGG - Intronic
994312875 5:98296691-98296713 ACCATTCCAGTGATGAGAAGAGG - Intergenic
999336844 5:150727038-150727060 GCCACTGCAGGGGTTAGGGGCGG + Intronic
999404149 5:151292269-151292291 GCCACTCTAATGATTAGATGAGG - Intronic
999416886 5:151406099-151406121 GCAGCACCAGTGATTGGAGGGGG - Intergenic
1001136796 5:169109169-169109191 GTCACTCCTGTGATTAGATTAGG + Intronic
1003520413 6:6853877-6853899 TCCATTCCAGTGAGAAGAGGTGG + Intergenic
1004650302 6:17601052-17601074 GCCACTCCAGTGACGAGGGTAGG + Exonic
1004860227 6:19796424-19796446 GCCACTCCAGTGAGGTGGGGAGG - Intergenic
1006645585 6:35512332-35512354 GCGGCTCAAGGGATTAGAGGGGG - Intronic
1010528930 6:76942415-76942437 GCCTCTCCAGGCACTAGAGGAGG + Intergenic
1014069947 6:117169217-117169239 TCCAGTCCTGTGATCAGAGGAGG - Intergenic
1015648941 6:135431963-135431985 GTTACTCCAGTGGGTAGAGGTGG - Intronic
1017410487 6:154162646-154162668 AACACTCCAGTGAGAAGAGGTGG - Intronic
1017484824 6:154892767-154892789 TCCACTCCAGAGGTCAGAGGTGG + Intronic
1018197585 6:161368634-161368656 GCCACTGCAGTGAGGGGAGGGGG - Intronic
1019413312 7:916043-916065 GCCACTCCAGGGGCCAGAGGCGG + Intronic
1023784733 7:43694663-43694685 GCTATTCCAGTGTTTAGAGTTGG - Intronic
1025083457 7:56004058-56004080 ACCCCTCCAGTGATTAGGAGAGG + Intergenic
1026095142 7:67340965-67340987 GAAACTCCAGTGATATGAGGTGG - Intergenic
1029613944 7:101644694-101644716 GCCCCTACAGAGATTGGAGGGGG + Intergenic
1030084314 7:105803874-105803896 GCCTCTCCAGTGATCAGAGATGG + Intronic
1030378867 7:108788174-108788196 GCTAAGGCAGTGATTAGAGGGGG - Intergenic
1031341583 7:120609301-120609323 TTCACTCCACTGATGAGAGGCGG + Intronic
1033614327 7:142997892-142997914 TTCACCCCAGTGATAAGAGGTGG - Intergenic
1036805993 8:11834195-11834217 GCTTCTCCAGTGCTTAGTGGGGG + Intronic
1043426709 8:80155303-80155325 CCTATTCCAGTGATTTGAGGTGG + Intronic
1046906912 8:119583231-119583253 GCCAGTCTGGTGGTTAGAGGGGG - Intronic
1050358235 9:4803692-4803714 GCCTCCCCAGTGAGAAGAGGAGG - Intronic
1052832044 9:33223562-33223584 GCCACTGCAGAGGTCAGAGGAGG - Intronic
1053543803 9:39001902-39001924 GCAACCTCAGTGATTTGAGGAGG - Intergenic
1053808230 9:41825399-41825421 GCAACCTCAGTGATTTGAGGAGG - Intergenic
1054622362 9:67362029-67362051 GCAACCTCAGTGATTTGAGGAGG + Intergenic
1056923823 9:90815334-90815356 GGCACCCCAGTGAGCAGAGGTGG + Intronic
1057311731 9:93947452-93947474 GCCATTCCAGTGAACAGTGGTGG - Intergenic
1059154637 9:111978964-111978986 GCCACTGCAGTCATTCGAGAGGG - Intergenic
1060259579 9:122062206-122062228 GACACTGCACTGATCAGAGGAGG + Intronic
1061012191 9:127962266-127962288 GACACTCCAGTGGCCAGAGGTGG - Intronic
1192534148 X:71913093-71913115 GCCACACCAGGGATGAGAGATGG - Intergenic
1192859929 X:75056651-75056673 GCCTCTTCAGTGAATAGAGTTGG + Intronic
1198667452 X:139040263-139040285 GTTACTACAGTGATTAGATGAGG - Intronic
1199700870 X:150374745-150374767 GCCAGTCCAGTGCCTTGAGGAGG + Intronic
1200984295 Y:9289739-9289761 GCAACTCCAGTGAACACAGGTGG + Intergenic
1201278761 Y:12322234-12322256 GCCACTCCAGTGATGAAGGGAGG + Intergenic
1201694174 Y:16806590-16806612 GCCACTGATGTGATAAGAGGCGG - Intergenic
1202126148 Y:21570500-21570522 GCAACTCCAGTGAACACAGGTGG - Intergenic
1202152856 Y:21858906-21858928 GCAACTCCAGTGAACACAGGTGG + Intergenic