ID: 1173847174

View in Genome Browser
Species Human (GRCh38)
Location 20:46195572-46195594
Sequence GCACTCCCGCCTCCCAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173847174 Original CRISPR GCACTCCCGCCTCCCAGTGT TGG Intronic
900268148 1:1770797-1770819 CCACCTCGGCCTCCCAGTGTTGG - Intronic
900375935 1:2354803-2354825 GCAGCCCAGCCTCCCAGGGTTGG + Intronic
900475765 1:2875707-2875729 CCACTCCCGTTTCCCGGTGTGGG + Intergenic
900548743 1:3243123-3243145 CCACTCCAGCCTCCCTGTCTCGG + Intronic
901245068 1:7723852-7723874 GAACTCCAGCCTGCCAGTCTGGG - Intronic
901568807 1:10142421-10142443 CCACCTCGGCCTCCCAGTGTTGG - Intronic
902671634 1:17978614-17978636 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
902912525 1:19610984-19611006 GCACTCCAGCCTTCCAGCCTGGG - Intronic
903598673 1:24517147-24517169 GCACTCCAGCCTTCCAGCCTGGG - Intronic
904024989 1:27497110-27497132 GACCTCCCCGCTCCCAGTGTGGG + Intergenic
904777478 1:32919833-32919855 GTACACCCGCCTCCCAGCCTGGG + Intergenic
904901430 1:33860563-33860585 GCACTCCCCCTCTCCAGTGTGGG - Exonic
905190866 1:36233469-36233491 GCACTCCAGCCTTCCAGCCTGGG + Intronic
906121058 1:43391065-43391087 CCACCTCGGCCTCCCAGTGTTGG - Intronic
908258092 1:62318890-62318912 GCGCCCCCGCCTCCCAGCCTGGG - Intronic
909264746 1:73542180-73542202 CCACCTCGGCCTCCCAGTGTTGG + Intergenic
910216725 1:84850982-84851004 GCATACCCTCCTCCCAGTGCTGG - Intronic
910544557 1:88399047-88399069 GCCCTTCCACCTCCCAGTATGGG + Intergenic
912329149 1:108801701-108801723 GCACTCCTGCACTCCAGTGTGGG - Intronic
912706749 1:111920491-111920513 GCACTCAAGCCTCCCAGTGCTGG + Intronic
914899044 1:151702336-151702358 TCCCTCCCCCTTCCCAGTGTGGG + Intergenic
915172265 1:153986276-153986298 CCAGTCCCGCCTACCAGTGCCGG - Exonic
916266195 1:162892039-162892061 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
917645243 1:177023390-177023412 GTGCTCCCGCCTACCAGTTTCGG + Exonic
920053728 1:203178409-203178431 GCCCTCCAGCCTCCCAGTGAGGG - Intergenic
922489702 1:226006113-226006135 GCACTACTGCATTCCAGTGTGGG + Intergenic
923671499 1:236045162-236045184 GCACTCCAGCCTTCCAGCTTGGG + Intronic
924581522 1:245328169-245328191 GCACCCCCACCTCCCAGCCTGGG - Intronic
1064732524 10:18347210-18347232 GCACTCCAGCCTGCCAGCCTGGG - Intronic
1065703099 10:28444447-28444469 GCACTCGCTGCTTCCAGTGTTGG + Intergenic
1067657910 10:48211240-48211262 GCACTGCAGTCTCCCCGTGTGGG - Intronic
1068186882 10:53596479-53596501 GTACCCCTGCCTCCCACTGTGGG - Intergenic
1069772273 10:70907499-70907521 GCACTCCCACCTGGCAGGGTGGG - Intergenic
1069963741 10:72096256-72096278 GCATTCCCGCCTCCCTCTGCTGG + Intronic
1070569242 10:77628605-77628627 GCACTCCAGCCTGCCAGCCTGGG + Intronic
1072105140 10:92266604-92266626 CCCCTCCCGCTTCCCATTGTAGG - Intronic
1074966742 10:118497442-118497464 GCACTTCTGTCTCCCAGTGCCGG + Intergenic
1076266535 10:129113428-129113450 GAACTCCGGCCTGCCAGAGTTGG - Intergenic
1077093884 11:791296-791318 GCAAGCCCGCCACCCACTGTGGG - Exonic
1079104838 11:17563943-17563965 TCTCTTCAGCCTCCCAGTGTTGG + Intronic
1082066990 11:47909096-47909118 GCACTCCAGCCTGCCAGCCTGGG - Intergenic
1083276907 11:61602001-61602023 GCTCTCTCCCCTCCCAGAGTGGG - Intergenic
1084948793 11:72653468-72653490 CCACTCCCGACTCCCAGGGAGGG + Intronic
1085001631 11:73042172-73042194 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1085159586 11:74328214-74328236 GCCCTGCCGCCACCCAGTCTGGG + Intergenic
1085307259 11:75494250-75494272 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1085406536 11:76266385-76266407 CCACTCCCACCTGCAAGTGTCGG + Intergenic
1085426600 11:76410218-76410240 GCACTCCAGCCTCCCAAAGAGGG + Intronic
1085556388 11:77426353-77426375 TGACTCCCACCTCCCACTGTTGG + Intronic
1085633611 11:78140434-78140456 CCACCTCGGCCTCCCAGTGTTGG - Intergenic
1086099427 11:83083383-83083405 TCACCTCAGCCTCCCAGTGTTGG - Intergenic
1087274779 11:96150370-96150392 CCACTCCCTGCTCCCAGTCTGGG - Intronic
1087873857 11:103332023-103332045 GCACTCCAGCCTTCCAGCCTGGG + Intronic
1088937039 11:114412867-114412889 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1089510716 11:118995300-118995322 GCACTCCAGCCTGCCAGCCTGGG - Intergenic
1092769656 12:11885082-11885104 CCATTCCCTCCTCCCAGTTTGGG - Intronic
1096402452 12:51318507-51318529 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1097841812 12:64328814-64328836 TCACCTCAGCCTCCCAGTGTTGG - Intronic
1100040730 12:90314023-90314045 GCACTCCACCCTCAAAGTGTTGG - Intergenic
1100603646 12:96133302-96133324 TCATTCCCGCTTCCCAGTTTTGG - Intergenic
1101674966 12:106909206-106909228 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1101806339 12:108067556-108067578 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
1102908277 12:116694046-116694068 GCCCTCCCCACTCCCAGTGCCGG - Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104006842 12:124898856-124898878 GCACTGCCCCCTCCCAGCGTGGG - Intergenic
1105002841 12:132702449-132702471 GCACCCCATCCTCCCAGTGTGGG - Intronic
1105233572 13:18523721-18523743 GTACTACTGCCTGCCAGTGTGGG + Intergenic
1107045495 13:35988138-35988160 GCACTCCAGCCACTCAGGGTTGG - Intronic
1107858459 13:44638161-44638183 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1108893081 13:55286850-55286872 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1110016787 13:70415706-70415728 CCACTTCAGCCTCCCAGTGTTGG - Intergenic
1110114164 13:71791413-71791435 GCACTCCCGCCTGCCACTTGGGG - Intronic
1110283436 13:73721798-73721820 CCACTTCGGCGTCCCAGTGTTGG + Intronic
1112365464 13:98752293-98752315 GCACTCCCGGCCCGCAGGGTGGG + Intronic
1115257777 14:31420720-31420742 GCAGTCACGCCTGCCAGAGTGGG - Intronic
1116403147 14:44533758-44533780 ACTCTCCCTCCTCCCAGTCTAGG - Intergenic
1116438243 14:44919426-44919448 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
1118665314 14:68062772-68062794 GCACTCCAGCCTGCCAGCCTGGG + Intronic
1118850243 14:69577520-69577542 GCACTCCAGCCTCTCACTCTAGG + Intergenic
1121321648 14:92995064-92995086 CCTCTCCCGGCTCCCAGTGGTGG - Intronic
1121576857 14:94995803-94995825 ACATTCCTGCCTCCCACTGTTGG + Intergenic
1122235572 14:100329147-100329169 GGCCTCCTGCCTCCCAGAGTGGG + Intronic
1122629802 14:103102449-103102471 GCACCGCCTCCTCCCAGTGCTGG - Exonic
1122951471 14:105047434-105047456 TCATTCCCGCCTCCCTGCGTGGG + Intergenic
1123937180 15:25199671-25199693 GCAGCCCAGCCTCCCTGTGTGGG + Intergenic
1124126477 15:26942094-26942116 GCAGGCCTGGCTCCCAGTGTGGG + Intronic
1124400163 15:29341036-29341058 TCACTCCCGCCTTCCAGTGAAGG + Intronic
1127397247 15:58552561-58552583 GCACTCCAGGCTCCCTGGGTCGG + Intronic
1128181392 15:65608320-65608342 GCACTCCAGCCTTCCAGCCTGGG + Intronic
1128989520 15:72247418-72247440 CCACGTCAGCCTCCCAGTGTTGG + Intronic
1129173054 15:73819617-73819639 CCACCTCAGCCTCCCAGTGTAGG + Intergenic
1129397160 15:75258328-75258350 GCCCTCCCCTCTCCCAGAGTAGG + Intergenic
1131120826 15:89822616-89822638 GCCCTCCCTCGTCACAGTGTGGG - Intergenic
1131494928 15:92900119-92900141 GCCCTCCCCCCTCCCCCTGTTGG + Exonic
1132208330 15:100001932-100001954 GCACTCCAGCCTGCCAGCCTTGG + Intronic
1132611246 16:817321-817343 GCACTCGCCCCTCCCAGCCTTGG - Intergenic
1132792987 16:1703801-1703823 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1132887664 16:2189659-2189681 GCCCTCCCACCCCCCAGGGTTGG - Intronic
1132887696 16:2189765-2189787 GCATTCCCACCTCCCAGGGTTGG - Intronic
1133291261 16:4722881-4722903 GCACTCCAGCCTTCCAGCCTGGG + Intronic
1133302749 16:4792765-4792787 GCACTCCAGCCTGCCAGCCTGGG + Intronic
1134616781 16:15657632-15657654 GCATTCCAGCCTCCCAGCCTGGG - Intronic
1135543999 16:23353799-23353821 GCATACCAGCCTCCCAGTGCAGG - Intronic
1136062134 16:27733997-27734019 GCACACCCACCACCCAGTGGAGG + Intronic
1136633825 16:31506746-31506768 GCACTCCTGCATCCCAGCCTGGG + Intronic
1138416368 16:56873744-56873766 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1138795558 16:59964184-59964206 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
1139216002 16:65124023-65124045 CCACTCCTGCCTCCCCCTGTGGG + Intronic
1139814641 16:69658579-69658601 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1140436414 16:74950687-74950709 GCACAGCCGCCTCCCAGTCGAGG - Intronic
1141515776 16:84544064-84544086 CCGCTCCAGCCTCCCAGAGTGGG + Intronic
1142127562 16:88417754-88417776 GCACCTCCACCTCCCAGTGCCGG + Intergenic
1142320697 16:89380929-89380951 GCATCCCTGCTTCCCAGTGTGGG + Intronic
1142595839 17:1029572-1029594 GCAATCCCTCCTGCCAGTCTGGG + Intronic
1144203240 17:12960318-12960340 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1144665345 17:17098574-17098596 GGATTCCCTCCTCCGAGTGTGGG - Intronic
1144852121 17:18249097-18249119 GCACCCCCACCTCACATTGTTGG + Intronic
1146613705 17:34333809-34333831 CCTCTCCCTCCGCCCAGTGTGGG - Intergenic
1147781798 17:42948429-42948451 CCACTTTGGCCTCCCAGTGTTGG - Intergenic
1147998976 17:44376640-44376662 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1149402413 17:56312080-56312102 TCACCCCCACCACCCAGTGTTGG + Intronic
1149485275 17:57037776-57037798 CCACCTCTGCCTCCCAGTGTTGG + Intergenic
1150225530 17:63522871-63522893 GCAGTCTCCCCTCCCAGTGCAGG - Intergenic
1151481778 17:74373815-74373837 CAACTCCCGCCTCCCAGTGGTGG - Intergenic
1151706121 17:75768845-75768867 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1151754150 17:76062035-76062057 TCACCTCGGCCTCCCAGTGTTGG - Intronic
1151794905 17:76337638-76337660 GCACTCTCGCCTTCCAGCCTGGG - Intronic
1152230264 17:79110831-79110853 CCACTCCCACCTCCCAGCCTGGG + Intronic
1152643912 17:81460207-81460229 GCAGCCCCGCCTCCCTGTTTCGG + Intronic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1154519452 18:15211732-15211754 GTACTACTGCCTGCCAGTGTGGG - Intergenic
1157259881 18:46168505-46168527 CCACCTCGGCCTCCCAGTGTTGG - Intergenic
1158986323 18:62821180-62821202 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1160366265 18:78328584-78328606 GCACTCCAGCCTGCCAGCCTGGG - Intergenic
1160430136 18:78805314-78805336 TCACTCCCCTCTCTCAGTGTAGG - Intergenic
1160802749 19:977783-977805 CCGCTCCAGCCTCCGAGTGTTGG - Intergenic
1161570623 19:5028943-5028965 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1162712612 19:12607090-12607112 CCACATCAGCCTCCCAGTGTTGG - Intronic
1162766981 19:12925603-12925625 CCACCTCGGCCTCCCAGTGTTGG + Intronic
1163253239 19:16139330-16139352 ACACCCCAGCCTCCCAGTGTTGG - Intronic
1165273595 19:34731152-34731174 TGGCTCCCACCTCCCAGTGTGGG + Intergenic
1165722462 19:38089281-38089303 GCACTCCAGCCTGCCAGCCTGGG + Intronic
1168561699 19:57389982-57390004 TCACTCCCGCCTCTCCGTGGTGG - Exonic
1168637616 19:58008804-58008826 GCACTCCAGCCTCCCATAATAGG - Exonic
1168637851 19:58010117-58010139 GCACTCCAGCCTCCCATAATAGG - Exonic
1168639658 19:58022465-58022487 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
926518147 2:13875795-13875817 TCACTTCAGCCTCCCAGTGCTGG - Intergenic
927641874 2:24850444-24850466 GCACTCCTGTCCCCCACTGTGGG - Intronic
927737616 2:25536290-25536312 GCCCGCCCGCCACCCCGTGTAGG - Intronic
928584505 2:32745011-32745033 GCACTCCAGCCTGCCAGCCTGGG + Intronic
929202164 2:39246990-39247012 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
931763561 2:65436091-65436113 GCCCTCCCCCCTCCCAGGGGCGG + Intergenic
932232069 2:70090975-70090997 CCACCTCGGCCTCCCAGTGTTGG - Intergenic
932282310 2:70504162-70504184 CCACCTCGGCCTCCCAGTGTTGG - Intronic
933916903 2:87004562-87004584 CCACTTCAGCCTCACAGTGTTGG - Intronic
934006092 2:87765352-87765374 CCACTTCAGCCTCACAGTGTTGG + Intronic
934709965 2:96508339-96508361 ACACACCCGTCTCCCAGGGTGGG + Intergenic
935684089 2:105668403-105668425 GCATTGCATCCTCCCAGTGTTGG + Intergenic
935769694 2:106405621-106405643 CCACTTCAGCCTCACAGTGTTGG + Intronic
935872222 2:107463472-107463494 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
935888235 2:107648160-107648182 CCACGTCAGCCTCCCAGTGTTGG + Intergenic
935920409 2:108006563-108006585 GCACACCCTCCTCCCAGTTTTGG + Intronic
936132194 2:109855442-109855464 CCACTTCAGCCTCACAGTGTTGG - Intronic
936212503 2:110516043-110516065 CCACTTCAGCCTCACAGTGTTGG + Intronic
936421643 2:112370618-112370640 CCACTTCAGCCTCACAGTGTTGG + Intronic
937381741 2:121383491-121383513 GAACACCCACCTCCGAGTGTGGG + Intronic
941334957 2:164230586-164230608 GCACTCCAGCCTGCCAGCCTGGG + Intergenic
941713882 2:168744038-168744060 GCACTCCAGCCTTCCAGCCTGGG - Intronic
942045550 2:172097318-172097340 GCCCTCCCGACTCCCAGGCTTGG + Intergenic
945069630 2:205977312-205977334 GGCCTGCCGGCTCCCAGTGTGGG - Intergenic
945661306 2:212688356-212688378 GCATTCCCACCTCTCAGTATTGG + Intergenic
945690631 2:213030858-213030880 GCACTCCTGCCCTCCAGTCTGGG - Intronic
947865214 2:233393057-233393079 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1169239414 20:3962946-3962968 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1170212507 20:13859741-13859763 GCACTCCAGCCTGCCAGCCTGGG - Intronic
1170300219 20:14875344-14875366 GCACTCCAGCCTTCTAGTCTGGG + Intronic
1170688723 20:18592715-18592737 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1170893541 20:20395399-20395421 GCACTGCCTCCTCCCGGTGATGG + Intronic
1171221843 20:23405236-23405258 GCACTCCAGCCCACCAGTCTAGG + Intronic
1173799833 20:45888050-45888072 GCACTCCAGCCTTCCAGTCATGG - Intergenic
1173838973 20:46144632-46144654 GCATTCCTGCAGCCCAGTGTGGG - Intergenic
1173847174 20:46195572-46195594 GCACTCCCGCCTCCCAGTGTTGG + Intronic
1174216340 20:48919559-48919581 CTACTTCAGCCTCCCAGTGTTGG + Intergenic
1175099348 20:56567448-56567470 CCACCTCGGCCTCCCAGTGTTGG + Intergenic
1175989367 20:62780037-62780059 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1176417113 21:6482825-6482847 CCACTCCCCCACCCCAGTGTGGG - Intergenic
1176777556 21:13152004-13152026 GTACTACTGCCTGCCAGTGTGGG + Intergenic
1178506331 21:33166230-33166252 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1179692611 21:43091158-43091180 CCACTCCCCCACCCCAGTGTGGG - Intergenic
1180900678 22:19369682-19369704 CCACCTCGGCCTCCCAGTGTTGG - Intronic
1181289283 22:21778546-21778568 GCACTCCAGCCTTCCAGCCTGGG + Intronic
1181603173 22:23964319-23964341 GCACTGCAGCCTCCACGTGTTGG - Intergenic
1181605341 22:23976988-23977010 GCACTGCAGCCTCCACGTGTTGG + Intronic
1182477383 22:30583512-30583534 GCTCTCCTGCCTCCCTGTGCTGG - Intronic
1182896514 22:33863508-33863530 CCACCTCGGCCTCCCAGTGTTGG - Intronic
1182953276 22:34397288-34397310 GCACCACTGCCTTCCAGTGTGGG - Intergenic
1183461123 22:37951301-37951323 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1183484595 22:38082308-38082330 GCAGCCCCGCCTCCCAGGATGGG + Intronic
1184191579 22:42898603-42898625 GCTCTCCTGCCTCCCAGGGATGG + Intronic
1184598602 22:45529149-45529171 GCTCTCCCTCCTCCACGTGTCGG - Intronic
1185322017 22:50205863-50205885 GCCCTGCCTCCTCCCACTGTGGG + Intronic
949194320 3:1287319-1287341 GCACTGCCTCCTCCAATTGTGGG + Intronic
950348719 3:12325171-12325193 CCACCTCAGCCTCCCAGTGTTGG - Intronic
951406372 3:22304023-22304045 CCACCTCGGCCTCCCAGTGTTGG + Intronic
952408023 3:33022604-33022626 GCACTCCAGCCTACCAGCCTGGG - Intronic
953551971 3:43910012-43910034 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
953724957 3:45389515-45389537 GCACTCCCTCCTGCCTGTGCAGG + Intronic
953985826 3:47441953-47441975 TCACCTCAGCCTCCCAGTGTTGG + Intronic
956419413 3:69070891-69070913 TCACCTCAGCCTCCCAGTGTTGG + Intronic
959071741 3:101707823-101707845 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
959345908 3:105194142-105194164 CCACCCCCACCTCCTAGTGTGGG + Intergenic
960724094 3:120653045-120653067 GCATGCCAGCCTCCCTGTGTGGG + Intronic
962998715 3:140656232-140656254 CCATTCCAGCCTGCCAGTGTTGG + Intergenic
963140568 3:141943004-141943026 CCACCTCGGCCTCCCAGTGTTGG + Intergenic
963738654 3:149051908-149051930 CCACCTCGGCCTCCCAGTGTTGG - Intronic
965080892 3:164030355-164030377 GCATTCCTTCCTCCTAGTGTGGG - Intergenic
966982833 3:185153544-185153566 GCACTCCCCCCACCCAGGGCGGG + Intergenic
968274706 3:197431527-197431549 CCACTCCCACCTCCTAGGGTGGG + Intergenic
968843623 4:3026709-3026731 GCTCTCCCGCCTCCCAGGGTGGG + Intronic
968852405 4:3092267-3092289 GCCCCTCGGCCTCCCAGTGTTGG + Intronic
969542558 4:7802682-7802704 GCACTCCAGCCTGCCAGCCTGGG - Intronic
970395465 4:15660827-15660849 CCACCTCGGCCTCCCAGTGTTGG - Intronic
975817476 4:78234033-78234055 GCACTTCCTGCTCCCAGAGTGGG + Intronic
976278648 4:83304576-83304598 CCACCTCAGCCTCCCAGTGTTGG - Intronic
977176555 4:93827391-93827413 GCACTCCCGCGCCCCAGGGGCGG + Intergenic
979935651 4:126690951-126690973 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
982733140 4:158977859-158977881 GCACCTCTGCCTCCCAGTGCTGG + Intronic
983288070 4:165764786-165764808 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
985012095 4:185593175-185593197 TCACTCTCGACTCACAGTGTGGG + Intronic
985487963 5:162575-162597 GCAGTCCCGCCACCCAGTGGGGG - Intronic
985525341 5:398701-398723 GCAATGCCTCCTCCCAGTGTCGG - Intronic
985550635 5:531768-531790 GCATTCCCACCTGCCAGTGGGGG + Intergenic
985858050 5:2446486-2446508 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
987553779 5:19418219-19418241 GCACTCCAGCCCTCCAGTCTGGG + Intergenic
991379801 5:66008167-66008189 CCACCTCAGCCTCCCAGTGTTGG - Intronic
992129122 5:73673922-73673944 CCACCTCAGCCTCCCAGTGTTGG - Intronic
992478529 5:77127372-77127394 TCACTCCCGCCACCCTGTGAAGG + Intergenic
992797033 5:80262705-80262727 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
993785575 5:92130781-92130803 CCGCTTCAGCCTCCCAGTGTTGG - Intergenic
994946183 5:106395080-106395102 GCACTCCAGCCTCCCAGACTGGG - Intergenic
997739921 5:136244276-136244298 CCACCTCAGCCTCCCAGTGTTGG + Intronic
999324440 5:150634781-150634803 GCACTCCAGCCTGCCAGCCTGGG + Intronic
1003218695 6:4137158-4137180 CCGCTTCGGCCTCCCAGTGTTGG + Intergenic
1003924403 6:10863207-10863229 CCACATCGGCCTCCCAGTGTTGG - Intronic
1004114178 6:12750018-12750040 GCACTTCCTCCTCCCCGTGCCGG - Intronic
1004434609 6:15578198-15578220 ACACCCCCTCCTCCCAGCGTCGG - Intronic
1006820288 6:36887970-36887992 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1007235895 6:40391371-40391393 TCACTCACCCCTTCCAGTGTCGG + Intergenic
1007469668 6:42080621-42080643 CCACCTCGGCCTCCCAGTGTGGG + Exonic
1007594212 6:43041558-43041580 GCACCACTGCATCCCAGTGTGGG + Intronic
1008174208 6:48246657-48246679 CCACTCCCTCCTCCCAATGGAGG - Intergenic
1016921546 6:149299759-149299781 CTGCCCCCGCCTCCCAGTGTTGG - Intronic
1017664622 6:156707554-156707576 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
1017727874 6:157288059-157288081 GCACTTCCACCTGCCAGGGTGGG - Intergenic
1018501063 6:164411591-164411613 GCCCTCCCTCCCCCCAGCGTGGG + Intergenic
1019738681 7:2662441-2662463 GCTCACCCGCCACCCAGTGCTGG + Exonic
1019856687 7:3615917-3615939 GCACTCCAGCCTGGCAGTGTGGG - Intronic
1020016413 7:4834517-4834539 GCGCTCCCGCCTCCCAGCCGGGG + Intronic
1020461996 7:8436703-8436725 GCACTCCCGCAGCCCAGGATGGG - Intronic
1021841930 7:24727955-24727977 GCACCCCCGACTCGTAGTGTGGG - Intronic
1022117082 7:27270607-27270629 TTGCTTCCGCCTCCCAGTGTTGG + Intergenic
1024114050 7:46175487-46175509 GCTCTGCTGCCTCCCAGTCTGGG - Intergenic
1028541280 7:91945111-91945133 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1029189592 7:98762208-98762230 GCACCCCTCCCTCCCAGCGTGGG + Intergenic
1029933621 7:104399494-104399516 GCACTCCAGCCTGCCAGCCTGGG - Intronic
1030027088 7:105334803-105334825 GCACTCCAGCCTTCCAGCCTGGG + Intronic
1030370631 7:108695214-108695236 GCTCTGCCCCTTCCCAGTGTGGG + Intergenic
1032194315 7:129780600-129780622 CCCCTCCCCCCTCCCAGGGTCGG - Intergenic
1032386908 7:131531432-131531454 TCACTCTCGCCAACCAGTGTCGG + Intronic
1036643345 8:10597598-10597620 ACGCTTCCTCCTCCCAGTGTCGG + Intergenic
1037608443 8:20456835-20456857 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1038325599 8:26570489-26570511 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1038455362 8:27669164-27669186 CCACTCCCTCCTCCCTGTCTGGG - Intronic
1040579904 8:48689321-48689343 GCACTCACTCCTCCCAGCCTGGG + Intergenic
1043712915 8:83445145-83445167 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
1044479562 8:92669435-92669457 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
1045163823 8:99580600-99580622 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1048254826 8:132897852-132897874 GCTCACTTGCCTCCCAGTGTGGG - Intronic
1048917386 8:139198123-139198145 GCACTCCAGCCTTCCAGGCTGGG + Intergenic
1049141639 8:140960455-140960477 CCACCTCGGCCTCCCAGTGTTGG + Intronic
1049258320 8:141625515-141625537 GCACACCTGCCTCCTGGTGTGGG - Intergenic
1049404840 8:142447718-142447740 GCACCCCCTCCTCCCAGTCCTGG - Intergenic
1050050943 9:1600930-1600952 CCACTTTGGCCTCCCAGTGTTGG - Intergenic
1050206800 9:3204886-3204908 GCATTCCTTCCTCCTAGTGTAGG - Intergenic
1050982314 9:12035949-12035971 GCACTTCCAACTCCCAGTGCTGG - Intergenic
1052036296 9:23684681-23684703 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
1052400450 9:27993500-27993522 GCACTCCAGCCTTCCAGCCTGGG + Intronic
1052551681 9:29958618-29958640 GCACTCCACATTCCCAGTGTTGG - Intergenic
1053344150 9:37365586-37365608 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1055591739 9:77822973-77822995 GCACTCCAGCCTGCCAGCCTGGG - Intronic
1055597484 9:77880413-77880435 GCACTCCAGCCTTCCAGTTTAGG - Intronic
1057600800 9:96455415-96455437 GCACTCCAGCCTGGCAGTCTGGG + Intronic
1057704621 9:97388116-97388138 GGACTCCTCCCTCCCAGCGTAGG - Intergenic
1058866672 9:109167260-109167282 GCACCCCCGCCTCCCTGCCTCGG + Exonic
1062327899 9:136021324-136021346 GCGGTCCCACCTCCCAGTGCGGG + Intronic
1062490310 9:136802035-136802057 TGCCTCCGGCCTCCCAGTGTTGG + Intronic
1186558066 X:10581852-10581874 TCACTTCCGCTTCCCAGTGAAGG + Intronic
1187219600 X:17310749-17310771 GCCCTCCTACCTCCCATTGTGGG + Intergenic
1187717637 X:22119135-22119157 CCACCTCCGCCTCCCTGTGTTGG + Intronic
1189413982 X:40798181-40798203 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1189824746 X:44906766-44906788 CCACCTCGGCCTCCCAGTGTTGG + Intronic
1190043041 X:47087226-47087248 ACACTGCCGCCTCACATTGTTGG + Intronic
1192119965 X:68446360-68446382 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
1192409863 X:70924510-70924532 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1193468949 X:81876333-81876355 CCACTCCCGCTTCCCAATGCAGG + Intergenic
1194090315 X:89576696-89576718 GCACTCCCAGATTCCAGTGTGGG - Intergenic
1196280297 X:113816261-113816283 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
1196606211 X:117660325-117660347 CCACTTCAGCCTCCCAGTGCTGG + Intergenic
1196846707 X:119902102-119902124 GCACTCCAGCCTTCCAGCCTGGG - Intronic
1196859748 X:120015793-120015815 GCACTCACCCCGCCCAGGGTGGG - Intergenic
1198127704 X:133662562-133662584 GCAATTCTGCCTTCCAGTGTGGG + Intronic
1198856674 X:141025051-141025073 CCACGTCGGCCTCCCAGTGTTGG - Intergenic
1198861647 X:141077122-141077144 GCACTCCAGCCTTCCAGCCTGGG + Intergenic
1198901044 X:141510260-141510282 GCACTCCAGCCTTCCAGCCTGGG - Intergenic
1198906018 X:141562316-141562338 CCACGTCGGCCTCCCAGTGTTGG + Intergenic
1200442965 Y:3232749-3232771 GCACTCCCAGATTCCAGTGTGGG - Intergenic